ID: 1113163391

View in Genome Browser
Species Human (GRCh38)
Location 13:107409628-107409650
Sequence CATGCACAAGGCTCTAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113163391_1113163393 15 Left 1113163391 13:107409628-107409650 CCTACACTAGAGCCTTGTGCATG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1113163393 13:107409666-107409688 ATCACAATGACCAATCAAATTGG 0: 1
1: 0
2: 0
3: 17
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113163391 Original CRISPR CATGCACAAGGCTCTAGTGT AGG (reversed) Intronic