ID: 1113163393

View in Genome Browser
Species Human (GRCh38)
Location 13:107409666-107409688
Sequence ATCACAATGACCAATCAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113163391_1113163393 15 Left 1113163391 13:107409628-107409650 CCTACACTAGAGCCTTGTGCATG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1113163393 13:107409666-107409688 ATCACAATGACCAATCAAATTGG 0: 1
1: 0
2: 0
3: 17
4: 167
1113163392_1113163393 3 Left 1113163392 13:107409640-107409662 CCTTGTGCATGTTGTCTCATTTG 0: 1
1: 0
2: 0
3: 28
4: 326
Right 1113163393 13:107409666-107409688 ATCACAATGACCAATCAAATTGG 0: 1
1: 0
2: 0
3: 17
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113163393 Original CRISPR ATCACAATGACCAATCAAAT TGG Intronic