ID: 1113163393 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:107409666-107409688 |
| Sequence | ATCACAATGACCAATCAAAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 185 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 17, 4: 167} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1113163391_1113163393 | 15 | Left | 1113163391 | 13:107409628-107409650 | CCTACACTAGAGCCTTGTGCATG | 0: 1 1: 0 2: 0 3: 8 4: 97 |
||
| Right | 1113163393 | 13:107409666-107409688 | ATCACAATGACCAATCAAATTGG | 0: 1 1: 0 2: 0 3: 17 4: 167 |
||||
| 1113163392_1113163393 | 3 | Left | 1113163392 | 13:107409640-107409662 | CCTTGTGCATGTTGTCTCATTTG | 0: 1 1: 0 2: 0 3: 28 4: 326 |
||
| Right | 1113163393 | 13:107409666-107409688 | ATCACAATGACCAATCAAATTGG | 0: 1 1: 0 2: 0 3: 17 4: 167 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1113163393 | Original CRISPR | ATCACAATGACCAATCAAAT TGG | Intronic | ||