ID: 1113172156

View in Genome Browser
Species Human (GRCh38)
Location 13:107516971-107516993
Sequence CTGTGGATGAAGAGGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 435}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113172152_1113172156 -4 Left 1113172152 13:107516952-107516974 CCATTTACTAGGCTGACATCTGT 0: 1
1: 0
2: 0
3: 14
4: 147
Right 1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG 0: 1
1: 0
2: 4
3: 42
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113172156 Original CRISPR CTGTGGATGAAGAGGTAGGA TGG Intronic
900120186 1:1045560-1045582 ATGGGGGTGAACAGGTAGGAGGG - Intronic
900365915 1:2311937-2311959 CTGAGGATGCAGAGGTAGGGTGG - Intergenic
901525779 1:9822983-9823005 CTTTGGGTGAAAAGGTGGGAGGG + Intronic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902398998 1:16147341-16147363 CTGTTGAGGGAGAGGTTGGAGGG - Intronic
904263714 1:29305747-29305769 ATGAGGCTGAAGAGGTAGGCAGG + Intronic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904433114 1:30477858-30477880 CTGTGTCTGAAGTGGTGGGAGGG - Intergenic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
904621402 1:31777460-31777482 GGGTGGATGCAGAGGTAAGAAGG - Intergenic
906065684 1:42978663-42978685 CTGTGTAAGATGAGGTGGGAAGG - Intergenic
909554844 1:76941981-76942003 GTGTGGGTGAAGAGATAGGCGGG + Intronic
910387186 1:86697752-86697774 CTGCTGATGAAGAGTAAGGAAGG - Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
911609271 1:99943223-99943245 CTGTGGATGAGGTTGTAGAAGGG + Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
912424068 1:109570759-109570781 ATGAGGGTGAAGAGGTAGGCAGG + Intronic
912866545 1:113262856-113262878 CTGTGGCTGAAGAGGGGGAAAGG + Intergenic
913483499 1:119312302-119312324 CTGTGTAGAAAGGGGTAGGATGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
918260093 1:182787914-182787936 GTGTGTGTGAAGAGGCAGGAGGG - Intergenic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918656387 1:187031311-187031333 GTGTGGATGAAGAGATTAGATGG - Intergenic
918657354 1:187044946-187044968 CTGTGGATGAAAAGGTCAAAAGG - Intergenic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
921555809 1:216597417-216597439 CTGTGCATGAAGAAGATGGAAGG + Intronic
922604241 1:226879354-226879376 CTCTGAGTGAAGAGGGAGGAGGG + Intronic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
923087200 1:230710711-230710733 TTGTGGATGACGAGGTGGAAGGG + Exonic
923441754 1:234027352-234027374 CTGTGGATGGTGAGGTGGCACGG - Intronic
924157934 1:241200610-241200632 CTGTGAAACAAGAGGTTGGAGGG - Intronic
924226309 1:241924576-241924598 CTGAGGAGGAAGAGGAAGGGGGG - Intergenic
924700301 1:246444564-246444586 TTGTGAATGGAGAGGTAGGAAGG + Intronic
1063644965 10:7870588-7870610 CTGTTGTTGAAGAGTTAGGATGG + Intronic
1064099523 10:12451370-12451392 GGGAGGAGGAAGAGGTAGGAGGG + Intronic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1065502121 10:26392504-26392526 CTGTGGATGAACAGACAGGAAGG - Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1067289071 10:44928369-44928391 AGGTGGATGAAGAGGTGGGTGGG - Intronic
1069726952 10:70586254-70586276 CTGAAGATGAGGAGGTGGGAGGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074501586 10:114029852-114029874 CGGTGGAGGAAGAGGTGGGAGGG - Intergenic
1075879450 10:125837848-125837870 CTGTCGGGGAAGAGGAAGGAGGG - Intronic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076266598 10:129113749-129113771 CTGGGAAAGAAGGGGTAGGATGG + Intergenic
1076402549 10:130193520-130193542 CTGTGGGTGAAAGGGCAGGAGGG - Intergenic
1076934000 10:133555439-133555461 CTGGACAGGAAGAGGTAGGATGG + Intronic
1079264679 11:18919891-18919913 CTGTGGATGGAGAGGAATGGGGG + Intergenic
1079304131 11:19307681-19307703 TTGTGGATGAAGATGAAGCATGG - Intergenic
1079335298 11:19565387-19565409 TCTTGGATGAAGAGGGAGGAGGG - Intronic
1080943242 11:36942870-36942892 ATGAGGATGAAGAGGTAGAAGGG + Intergenic
1081566366 11:44263543-44263565 CTGTGGAAGAAGTGTAAGGACGG + Exonic
1082059310 11:47847070-47847092 CTGAGGCTGGAGAGGTAGGCAGG - Intronic
1082063178 11:47877776-47877798 TTGTGGAGAAAGAGGAAGGAAGG - Intergenic
1082838770 11:57671071-57671093 TAGTGGATGAAAAGGTAGAAAGG + Intronic
1082877548 11:58003344-58003366 CTGTGGCTGGAGAGATAGGGTGG - Intergenic
1084161328 11:67352020-67352042 CTGTGGAAGATGGGGTGGGAGGG + Intronic
1084424710 11:69078347-69078369 CTGTGGCTGGATAGATAGGACGG + Intronic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088880925 11:113972672-113972694 GTGTGGAGCAAGAGGTAGGGAGG + Intergenic
1088896431 11:114082173-114082195 GGGTGGCTGAAGAGGGAGGATGG + Intronic
1088971798 11:114780443-114780465 ATGTGGTAGAAGAGTTAGGAAGG + Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089223006 11:116890857-116890879 CTGGGGCTGAAGAGCTAGGCAGG + Intronic
1089314745 11:117583747-117583769 CTGTGGATGAAGATGCAGAGAGG - Intronic
1090267804 11:125364501-125364523 CTTGGGATGAAGAGGGATGAAGG - Intronic
1091063581 11:132488013-132488035 CTGTGGCTGCAAAGGTAGGCTGG - Intronic
1091531222 12:1357843-1357865 CTGGGGATGAAGTTGGAGGAGGG - Intronic
1092132665 12:6123547-6123569 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093239076 12:16646809-16646831 CTGTGTATGAAGAGAAAGAAAGG + Intergenic
1093558679 12:20510821-20510843 CTGAGAGTGAAGAGGAAGGAAGG + Intronic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1098568023 12:71956986-71957008 CTATGAAAGAAGAGGTAGCATGG + Intronic
1101802814 12:108036993-108037015 CTGTGGATGGAGAGGTGTGTGGG + Intergenic
1103175238 12:118857795-118857817 GTGTGGTTGAAGAGGTAGCCTGG + Intergenic
1103199309 12:119073726-119073748 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1104266655 12:127239772-127239794 CTCTGGAAGAAGAGAAAGGAGGG + Intergenic
1104318859 12:127731189-127731211 CTGTGGATGCAGAGTGAGCAAGG - Intergenic
1104435633 12:128754285-128754307 CTGTTGAGCAAGAGTTAGGATGG + Intergenic
1105767049 13:23570568-23570590 CTGTGGACTAGGAGGTGGGAGGG + Intronic
1106055228 13:26231082-26231104 CTGTGGAGGAAGAGGTCAAAAGG - Intergenic
1106658332 13:31771479-31771501 CTATGGATGGAGAGGGGGGATGG - Intronic
1107415395 13:40195098-40195120 CTGGTGATGAAGAAGAAGGAGGG - Intergenic
1107435506 13:40377421-40377443 CGGTGGATGACGAGGCAAGAGGG + Intergenic
1107581119 13:41787545-41787567 TGGAGGATGAAGAGGGAGGAAGG + Intronic
1110982853 13:81924176-81924198 CTCTGGGTGATGGGGTAGGACGG - Intergenic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113304633 13:109064324-109064346 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1113618465 13:111697239-111697261 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113623994 13:111782500-111782522 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113723776 13:112581933-112581955 GTGTGGCTGAAGAGGTAAGTGGG - Intronic
1114066736 14:19066334-19066356 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1114095530 14:19333693-19333715 CTGTGTTTGAACAGGTAGGTTGG - Intergenic
1114525815 14:23366303-23366325 CTGGGGATTAAGAGAAAGGAGGG + Intergenic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1114896484 14:26996935-26996957 CTGAAGATGAAAAGGTAGCAGGG + Intergenic
1115273551 14:31581314-31581336 CTGGGGATGAATAGTGAGGATGG - Intronic
1116088377 14:40271170-40271192 CTGGGGCTGAAGAGGTAGGGGGG + Intergenic
1116779837 14:49224902-49224924 CTGTGGAAGAAGAGAAAAGATGG + Intergenic
1117399463 14:55345513-55345535 GTATGGATGAAGAGGGAGAAGGG - Intronic
1117403070 14:55375428-55375450 CTGTGGAGGCTGAGGTGGGAGGG - Intronic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1118203624 14:63701086-63701108 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1118603701 14:67488158-67488180 CTGTGGATGACCAGGCAGGATGG + Intronic
1120614425 14:86685527-86685549 CTCAGGAGGAAGAGGTGGGAGGG - Intergenic
1120903094 14:89592970-89592992 CATGGGATGAACAGGTAGGAAGG + Intronic
1120912640 14:89681694-89681716 CTAGGGATGAAAAGGAAGGAAGG - Intergenic
1121471473 14:94158053-94158075 CTCTGGATCAAGATGTAGGAGGG + Intronic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1122740930 14:103871343-103871365 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
1122847621 14:104509337-104509359 CTTTGGATAAATAGCTAGGAGGG - Intronic
1122943344 14:104993367-104993389 GTGTGGATGACGAGGCTGGAAGG + Intronic
1123128345 14:105965865-105965887 CTGTGGACTTAAAGGTAGGAGGG - Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1124099128 15:26677187-26677209 CTGTGATTTCAGAGGTAGGAAGG + Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1127003690 15:54541109-54541131 CTCTGGATAAAGAGGAAGGTTGG - Intronic
1128134845 15:65255196-65255218 CTGGGAATGGAGAGGCAGGAAGG - Intronic
1128187524 15:65655667-65655689 CTGAAGATGAAAAGATAGGACGG + Exonic
1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG + Intergenic
1129878578 15:78992836-78992858 CTGTGGAGGAAATGGGAGGAAGG - Intronic
1130029531 15:80299000-80299022 TTAAGAATGAAGAGGTAGGAGGG + Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1132503175 16:293599-293621 TCTTGGATGAAGAGGTGGGAGGG + Exonic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1133840173 16:9400913-9400935 ACGGGGATGAAGAGGAAGGAAGG + Intergenic
1134043433 16:11084829-11084851 CTGTGGAGAAAGAGGTAGCCGGG + Intronic
1134787833 16:16961121-16961143 CTGTTGTTGAATAGGCAGGAGGG - Intergenic
1135414500 16:22258392-22258414 CTGTGGATGAAGGGGTTTCAGGG + Intronic
1135967615 16:27049007-27049029 GTGAGGCTGGAGAGGTAGGAGGG - Intergenic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136540452 16:30925211-30925233 CTGTGGATGAAAAGGTTGGTGGG + Intronic
1137399429 16:48141320-48141342 TTTGGGATGAAGAGGTAGCAAGG - Exonic
1137520388 16:49190198-49190220 CTGTGGATGAAGAGTTAGGCAGG - Intergenic
1137797278 16:51232635-51232657 CTCTGGATGCTAAGGTAGGAGGG - Intergenic
1137813431 16:51375210-51375232 GTGTGGATGATGAAGTATGATGG + Intergenic
1138652836 16:58471614-58471636 CTGAGGATTAAGAGGCAGGGAGG - Intronic
1139771364 16:69280250-69280272 CTGTGTATAAAGAGGTAGACAGG - Intronic
1140124083 16:72105996-72106018 CTGGGGTTGAAGACCTAGGAGGG - Exonic
1140264460 16:73408460-73408482 CTGGGGATGAAAAGGAAGGGTGG - Intergenic
1140651572 16:77094134-77094156 GTGTACATGAAGAGGAAGGAAGG - Intergenic
1140734208 16:77883765-77883787 CATCGGATGAAGAGGGAGGAGGG - Intronic
1141134125 16:81454856-81454878 ATCTGGATGGAGAGGTAGGATGG + Intronic
1141458868 16:84164418-84164440 TTGGGGCTGAGGAGGTAGGAGGG - Intronic
1141611356 16:85182811-85182833 CTGTGGATGCTGGGGCAGGAGGG - Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1142269368 16:89081205-89081227 CTGTGGAGGAGCAGGTGGGAGGG + Intergenic
1143180794 17:4982806-4982828 CTCTGGAAGAAGCGGAAGGATGG - Exonic
1143185441 17:5007329-5007351 CTGAGGATGGAGAGGTGTGAGGG + Exonic
1143197842 17:5089761-5089783 CTGGGGAGGCTGAGGTAGGAGGG - Intronic
1143625624 17:8108956-8108978 GTGTGGATGCAGGGGAAGGAGGG - Intronic
1143778193 17:9213016-9213038 AGGTGGAGGAAGAGGCAGGACGG + Intronic
1145857607 17:28177128-28177150 CTGAGGAGGAAGAGAAAGGAGGG + Intronic
1146535465 17:33646975-33646997 CTTTGGAAGATGAGGTAGGTGGG + Intronic
1148110640 17:45143256-45143278 CTGGGGAGGAAGATGTGGGAGGG + Intronic
1148227309 17:45907949-45907971 CTGAGGTTGCAGAGGCAGGAAGG - Intronic
1148444797 17:47731043-47731065 CTCTGGAGGAAGAGGAAGGCTGG - Intergenic
1148485529 17:47988356-47988378 CTGTGGAGGCTGAGGTGGGAGGG + Intergenic
1148749088 17:49934564-49934586 CTGTGGTGGAGCAGGTAGGAAGG + Intergenic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1150652917 17:67021613-67021635 CTGTGGAAGAGAAGGTAGGCAGG - Intronic
1150888425 17:69114753-69114775 AAGTGGAACAAGAGGTAGGAGGG - Exonic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151413631 17:73947507-73947529 GGGGGGATGAAGAGGTAGGTAGG + Intergenic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151925674 17:77194445-77194467 CTGGGGAGGCTGAGGTAGGATGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152533318 17:80934464-80934486 CTGGGGAGGAAGAGGTGGGAGGG - Intronic
1153466110 18:5389525-5389547 CTGTGGCTGGAGAAGTAGGTGGG + Intergenic
1153659035 18:7310170-7310192 GTGTGGATGGATAGGTAGGTAGG + Intergenic
1154031293 18:10756308-10756330 TGGAGGATGAAGAGGAAGGATGG + Intronic
1154957191 18:21270392-21270414 AGGTGGATGGAGTGGTAGGAGGG + Intronic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156327725 18:36089334-36089356 CTCTGGAGGATGAGGCAGGAGGG + Intergenic
1156961630 18:43039012-43039034 CAGTGAAGGAAAAGGTAGGAAGG - Intronic
1157998474 18:52587863-52587885 CTGGGGATGAGAAGGTAGGGTGG + Intronic
1158586082 18:58736345-58736367 CTCTGGATGAAGCGGGAGGGTGG - Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160229876 18:77039746-77039768 CTGTGAATCAAGTGGTAGGAAGG + Intronic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160872044 19:1282122-1282144 ATGTGAATGGAGAGGAAGGATGG + Intergenic
1161585090 19:5101659-5101681 CTGTGGATGCAGGGGAAGGGCGG + Intronic
1161585111 19:5101725-5101747 CTGTGGATGCAGGGGAAGGGCGG + Intronic
1161643362 19:5437285-5437307 CTGCGGATGAAGGGTGAGGAGGG + Intergenic
1161790713 19:6358177-6358199 CTGGGATTGAGGAGGTAGGAGGG - Intergenic
1163511774 19:17739693-17739715 CAGTGGACTAAGAGGTAGCAAGG - Intergenic
1163890384 19:20007495-20007517 CTGTGGTTGAAGAGGAAGATGGG + Intronic
1164948938 19:32319968-32319990 CTTGGGAGGATGAGGTAGGAGGG - Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1166145666 19:40833190-40833212 CTGTGGAGGAAGATGTAACATGG + Intronic
1166149775 19:40864092-40864114 CTGTGGAGGAAGATGTAACATGG + Intronic
1166171419 19:41029961-41029983 TTGTGGGGGAAGAGGTGGGAAGG + Intergenic
1166217001 19:41342298-41342320 CCCTGGAGGAAGAGGAAGGAAGG + Intronic
1166373590 19:42315278-42315300 GTGTGGGGGAAGAGATAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
927276285 2:21265115-21265137 CAGTGGATGGAGATGAAGGAAGG - Intergenic
927897050 2:26789625-26789647 CTGAGGATGAAGGGGCTGGAGGG - Intronic
928672716 2:33618882-33618904 CTGTGGATGAAAATGTCGGTAGG + Intergenic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
930697796 2:54429886-54429908 CTGTGGATCAAGAGGCTGGGTGG - Intergenic
931628980 2:64282667-64282689 CTGTGGAAGGAGAGGTAGAGGGG + Intergenic
932620045 2:73259821-73259843 ATGTGGCTGAAGGGGGAGGAAGG + Intronic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
934655774 2:96116328-96116350 CGGTGGAGGAGGATGTAGGAGGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
936521618 2:113215359-113215381 CTGAGGATGAAGAGGAGTGAGGG + Intergenic
936649283 2:114407760-114407782 CTGTGGATGAAGGATTATGAAGG - Intergenic
938159536 2:128973052-128973074 GTGTGGGAGAAAAGGTAGGAAGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938484133 2:131686428-131686450 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
939320369 2:140612422-140612444 ATGGGGATGAAGATGAAGGAAGG - Intronic
939618010 2:144381906-144381928 CTGTGGGTAGAGAGGTTGGATGG + Intergenic
939736866 2:145857969-145857991 GTGTGGCTGAAGAGGAATGAGGG - Intergenic
939800258 2:146699326-146699348 CTGGTGATGAAGAGGTTGAATGG - Intergenic
940301890 2:152184337-152184359 CTGGGGATGGGGAGGTAGGTAGG - Intergenic
940445706 2:153773752-153773774 CTGTGGAAGAAAAGGTAGAATGG + Intergenic
942428371 2:175883413-175883435 TTGTGGGTGGAGAGGTAGTAGGG + Intergenic
943736606 2:191363462-191363484 CTGTGGTTGAAGTGGAAGTAGGG + Intronic
945606132 2:211934556-211934578 TTGTGGATGAGGTGGAAGGAAGG - Intronic
945932299 2:215867084-215867106 CTGTGGCAGAAGAGGTGAGAGGG - Intergenic
946275396 2:218627935-218627957 CTCTGGATGGAGTGGGAGGAAGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946962927 2:225003721-225003743 TTGTGGTTTAAGAGATAGGATGG - Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948091864 2:235301984-235302006 AGGAGGATGAAGAGGGAGGAGGG - Intergenic
948303002 2:236922378-236922400 CAGTGGATGGAGAGGAAGGTTGG + Intergenic
948668074 2:239548657-239548679 CTGAGGGTGGAGAGGCAGGAGGG + Intergenic
948711164 2:239826589-239826611 CTGCGGATGAAGCGGCAGAACGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168944408 20:1739688-1739710 CTGTGGATTAACAAGTGGGAGGG - Intergenic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169553725 20:6727607-6727629 CTGTGGCTGATGAGGAATGAGGG + Intergenic
1169790433 20:9404271-9404293 CAGTGGATGAAGATGCAGGTAGG + Intronic
1170171575 20:13419290-13419312 GTGTGCATGTAGAGGGAGGAGGG + Intronic
1170389744 20:15859210-15859232 CTGAGGAGGAAGAGGAAGGGGGG + Intronic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1170956232 20:20982326-20982348 ATGTGGATGAAGAGGTATTATGG - Intergenic
1171320164 20:24236035-24236057 CTGGGGATGGAGAGGCAGGCAGG + Intergenic
1171958285 20:31475862-31475884 CTGAGGAGGAAGAGGCAGGAGGG - Intronic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174128798 20:48327440-48327462 CTGAGGATGAGGAGATAAGAAGG - Intergenic
1174730259 20:52909198-52909220 CTCTGGAGGATGAGGTGGGAAGG + Intergenic
1174761713 20:53212963-53212985 CTGTGGATCAAAAGTAAGGAGGG + Intronic
1175874308 20:62222157-62222179 CTGTGGATGACAGGGGAGGAGGG - Intergenic
1176113547 20:63421498-63421520 CTGTGGCTGATGGGGCAGGAAGG - Intronic
1176273616 20:64249773-64249795 CTCTGGAGGCTGAGGTAGGAAGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176723673 21:10413094-10413116 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1176796418 21:13373733-13373755 GTGTGGCTGGAGCGGTAGGAAGG + Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1177474971 21:21608364-21608386 CTGTGAATGAAGATTCAGGAAGG - Intergenic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1179082401 21:38183995-38184017 TTGTGGAGGAAGATGCAGGAAGG - Intronic
1179885727 21:44313532-44313554 CAGTGGATGGAGAGGCAGGCAGG - Intronic
1180304829 22:11065871-11065893 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1180485218 22:15788918-15788940 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1180936452 22:19628406-19628428 CTGTGAATGAAGTGGTTAGAAGG + Intergenic
1181994829 22:26869065-26869087 CTATGGATGGAGAGGGAGTAGGG + Intergenic
1182511460 22:30823033-30823055 CTGGGGAAGAAGAGGTAGATGGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182879000 22:33717196-33717218 GGGTGGATGAATGGGTAGGAAGG - Intronic
1183549169 22:38471235-38471257 CTGAGGATGAAGAGAAAAGAGGG + Intronic
1183718131 22:39546217-39546239 CTGTGGAGGGAGAGGTGGTAGGG - Intergenic
1184088721 22:42281479-42281501 CTGTGGCTGAAGCCGTTGGAAGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184445436 22:44544408-44544430 CTGATGATGCAGAGGTAAGAGGG - Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
950025809 3:9819248-9819270 CTGTGGAAGGATAGGTAGGCAGG - Intronic
950531242 3:13553413-13553435 CTGAGGAGGAAGAGCTGGGACGG + Intronic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951705654 3:25541820-25541842 CTGTGGAGGAAGGGGCCGGAGGG - Intronic
954318906 3:49817563-49817585 CTGAGGAGGCTGAGGTAGGAGGG + Intergenic
954758932 3:52860353-52860375 CTGTCAATGAGGAGGTATGAAGG + Intronic
954772448 3:52984036-52984058 ATGTGGAGGAAGATGTAAGATGG + Intronic
954904497 3:54048613-54048635 CTCTGGATGAAGTGGTCAGAGGG - Intergenic
956339359 3:68204418-68204440 CTGTGGACAAAGGGGTTGGAAGG - Intronic
956754067 3:72368167-72368189 CTGTGGAGTGCGAGGTAGGAAGG + Intergenic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
958672622 3:97223774-97223796 ATGTGGTTGGAGAGGTAGGCAGG + Intronic
959583239 3:108003117-108003139 CTGGGGATGGAGACGCAGGAGGG - Intergenic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
960116013 3:113893318-113893340 ATGTGGGTGGAGAGGTGGGAAGG - Intronic
961315242 3:126030633-126030655 GTGTGGGTGAATAGGTAGGTGGG + Intronic
961628766 3:128281461-128281483 CTTTGTATGCAGAGGTAGCATGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962292487 3:134148151-134148173 CAGGGGAGGAAGATGTAGGATGG - Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963260137 3:143184162-143184184 CTGGGAGTGAAGAGGCAGGAGGG - Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
964439204 3:156688266-156688288 CTGGGGATGCTGAGGTGGGAGGG + Intronic
964818671 3:160745562-160745584 CTGTGATTGAAGAGTCAGGAAGG + Intergenic
965629178 3:170713344-170713366 CTGTGGATGAAGAGCCAGCCTGG + Intronic
965912319 3:173794092-173794114 CTGGGTATGAGGAGGTAGGGTGG - Intronic
966411135 3:179647079-179647101 CTGAGGAGGCTGAGGTAGGAAGG + Intergenic
966709209 3:182952744-182952766 TTGTGTATGATGAGGAAGGAAGG - Intronic
966878084 3:184335039-184335061 AAGTGGCTGAAGAGGCAGGATGG + Exonic
970376839 4:15467350-15467372 TTGTGCAGGTAGAGGTAGGATGG + Intergenic
972379997 4:38510648-38510670 CTGTGGAGGAAAAGGTTGAAAGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
973829909 4:54748168-54748190 CTGTGGAGGAAGAGCTGGGCAGG - Intergenic
974935020 4:68401215-68401237 ATGAGGAGGAAGAGGTAAGAAGG - Intergenic
977689475 4:99889667-99889689 ATGTGGCTGGAGAGGAAGGATGG + Intronic
977700079 4:100011926-100011948 CTGTGATTGAGGTGGTAGGAGGG - Intergenic
978322238 4:107510463-107510485 CTGTGTATGGAGAGGTAGTTAGG + Intergenic
979548980 4:121969143-121969165 CAGTGGAAGAAAAGGAAGGAGGG - Intergenic
981917629 4:150052018-150052040 CTGAGGACGGAGAGGTAGGCAGG - Intergenic
982259160 4:153479322-153479344 ATGGGGATGAAGAGGAAAGAGGG - Intronic
982558280 4:156897125-156897147 TTGGGGATGAAGAGGCAGTAAGG + Intronic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
984364833 4:178785135-178785157 CTTTTGAAGAAGAAGTAGGAAGG - Intergenic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985252325 4:188036374-188036396 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
985721926 5:1493989-1494011 CAGAGGAGGAAGAGGCAGGAAGG + Intronic
986709365 5:10477480-10477502 CTGTTGATGGACAGGAAGGAAGG + Intergenic
987016184 5:13822356-13822378 CTCTGGATGCTGAGGTGGGAGGG - Intronic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
990669963 5:58117127-58117149 GTGTGGATGAAGGGGCTGGATGG + Intergenic
990982427 5:61614232-61614254 ATGAGGCTGAAGAGGTAGGGAGG + Intergenic
991061470 5:62380793-62380815 CTGAGGAGGAAGAGGCAGGCTGG + Intronic
992278217 5:75143465-75143487 CTGTCTGTTAAGAGGTAGGAAGG - Intronic
993390139 5:87310520-87310542 CTTTGCATAAAGAAGTAGGAAGG + Intronic
993588186 5:89759095-89759117 ATTTGGATGAGGAGGTGGGAAGG - Intergenic
993846682 5:92953280-92953302 CTGTGGTAGTAGAGGTAGGTTGG + Intergenic
996991086 5:129632977-129632999 GAGAGGATGGAGAGGTAGGAAGG - Intronic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998742561 5:145221428-145221450 CTGTGAAGGATGAGGTTGGAAGG + Intergenic
998742699 5:145223008-145223030 ATGTGGCTGAAGAGGTAGGTGGG + Intergenic
999177398 5:149640914-149640936 CTTGGGATGAAGAGGTGGGGTGG + Intergenic
999797905 5:155005242-155005264 CTGGGGAGTGAGAGGTAGGAGGG + Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1001980947 5:176036776-176036798 GTGTGGCTGGAGCGGTAGGAAGG + Intergenic
1002236512 5:177807289-177807311 GTGTGGCTGGAGCGGTAGGAAGG - Intergenic
1002239636 5:177829413-177829435 ATGCGGACGAAGAGGAAGGAGGG - Intergenic
1002273191 5:178086389-178086411 CTGGAGATGAGGAGGTAGGCGGG + Intergenic
1002335283 5:178473400-178473422 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1003039811 6:2677356-2677378 CTGTGGATCAACAGGTAGAAGGG - Intronic
1004578446 6:16923087-16923109 CTATAGATGAAGAGGTAGGTAGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1006913492 6:37579287-37579309 CTGAGGAGGATGGGGTAGGAAGG - Intergenic
1006990076 6:38207734-38207756 CTCTGAAGGAAAAGGTAGGAGGG + Intronic
1007938472 6:45754802-45754824 CTGAGAAAGAAGAGATAGGAAGG - Intergenic
1008557936 6:52693464-52693486 ATGTGGAAGAAGAGGTAATAAGG + Intergenic
1008779111 6:55080763-55080785 GTGTGGAGGAAGTGATAGGAGGG + Intergenic
1010865581 6:80973424-80973446 CTGTCTATGAAGATGAAGGAAGG - Intergenic
1011515052 6:88144802-88144824 CTGCCGATGAAGTGGTAGGAAGG + Exonic
1013165682 6:107589800-107589822 CTATCTATGAAGAGGTAGGTGGG - Intronic
1015055961 6:128903818-128903840 CTGTGGAGGATGGGGAAGGACGG + Intronic
1015228509 6:130886273-130886295 CTGTGGATTGAGAGGTAGCTTGG - Intronic
1015889158 6:137952124-137952146 TTCTGGATGAAGAGGAAGCAGGG - Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1018250683 6:161866899-161866921 CTCTGGCTGAAGAGGATGGATGG + Intronic
1018744765 6:166753488-166753510 CTGTGGAAGAACATGTAGAAAGG - Intronic
1018777781 6:167034226-167034248 CTGTGGATTAAGAGGGATCAGGG + Intronic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1022472155 7:30688629-30688651 CTGTGGATGCAGACCTGGGAAGG + Intronic
1022488532 7:30799154-30799176 CTGTAAATGAAGGGGTAGGATGG + Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022633216 7:32105640-32105662 GGGAGGATGAAGAGGGAGGATGG - Intronic
1023018576 7:35989140-35989162 GGGTGTATGAGGAGGTAGGAAGG - Intergenic
1023680310 7:42679062-42679084 CTCTGGATGAACAGGAAGCAGGG - Intergenic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1024127721 7:46317730-46317752 CTGTGGCTGGAAACGTAGGATGG + Intergenic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1026068080 7:67093057-67093079 CTGAGGAGGCAGAGGTGGGAGGG + Intronic
1026460829 7:70613864-70613886 ATGTTGATGAAAAGGTAGGCAGG - Intronic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1027364237 7:77440652-77440674 ATAAGGATGAAGAGGCAGGATGG + Intergenic
1029282031 7:99441529-99441551 ATGGGGATGAAGAGGAGGGATGG - Intronic
1029403358 7:100358595-100358617 CTGTGGGTGAAGGTGTGGGAGGG + Intronic
1030522199 7:110611724-110611746 GTGAGGAAGAACAGGTAGGAGGG + Intergenic
1030836942 7:114299590-114299612 CAGTTGATCAAGAGGTAGAAAGG - Intronic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1032883876 7:136116875-136116897 CTGTGGCTGAAGAGGAAGGAGGG - Intergenic
1032960439 7:137027355-137027377 GTGAGGATGGAGAGGAAGGAGGG - Intergenic
1033969678 7:147024772-147024794 CAGTGGATGAAGAGGAATCATGG + Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034478954 7:151305094-151305116 TGGCGGATGAGGAGGTAGGAGGG - Intergenic
1035064348 7:156094454-156094476 CTGTGGCTGACCAGGTGGGAGGG + Intergenic
1036388401 8:8302958-8302980 CTGGGGATGGATAGGTAGCAAGG + Intergenic
1036648402 8:10626094-10626116 CTGTGGAGGAAGGGGCAGGGCGG + Intronic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037559291 8:20058087-20058109 ATGTGGATGGAGAGATGGGAAGG - Intergenic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037638605 8:20722527-20722549 CTGAGAATGAAGTGGTAGGATGG + Intergenic
1037868869 8:22472455-22472477 CAGTGGATAAAGATGTAGGGGGG - Intronic
1037961155 8:23099315-23099337 CTGGGGATGAGGAGGTAGGGAGG - Intronic
1039963022 8:42264262-42264284 CTGGGGAGGCTGAGGTAGGAGGG - Intergenic
1041037840 8:53813543-53813565 CTGGAGATGAAAAGGTAGAAGGG - Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041322124 8:56624162-56624184 CAGTGTCTGAAGAGGTAGGAGGG - Intergenic
1041746367 8:61212570-61212592 TTTTGGAGGAAGAGGGAGGAAGG + Intronic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1042344946 8:67717823-67717845 CCATGGAGGAAGAGCTAGGAGGG + Intronic
1042781082 8:72491853-72491875 GTGTGGATCGAGAGGAAGGAAGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1046604103 8:116351541-116351563 CTGTGGTTGAAGAGGTGGCGAGG - Intergenic
1046654865 8:116882307-116882329 CTTGGGAGGCAGAGGTAGGAGGG - Intergenic
1046899433 8:119508151-119508173 CTGTGTAACAAGGGGTAGGAAGG + Intergenic
1047054885 8:121152998-121153020 CAGAGGAAGAAGAGGTAGAAGGG - Intergenic
1047266474 8:123314308-123314330 CTGTGGATGAATAGGCAAAAGGG + Intergenic
1047634770 8:126749006-126749028 CTTTGGAAGAACAAGTAGGAAGG + Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049203409 8:141352438-141352460 CTGTGTGTGAAGAGGCAGGGAGG + Intergenic
1049621565 8:143600593-143600615 CTGTGGCTGATGAGGAAGCAGGG - Exonic
1050388671 9:5114213-5114235 TTGCGGATGAACAGGTAGAAGGG - Intronic
1050585277 9:7104341-7104363 CAGTAAAGGAAGAGGTAGGATGG + Intergenic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054834411 9:69661397-69661419 CTGTGCAGGAAGAGATGGGAAGG + Intronic
1055599558 9:77901515-77901537 CTAAGGAGGAAGAGGCAGGACGG - Intronic
1055904523 9:81277322-81277344 TGGGGGATGAAGAGGTAGCATGG - Intergenic
1056125952 9:83537130-83537152 CTGTGGGTGAATATGTAGGCAGG - Intronic
1056507482 9:87270901-87270923 GTGGGGATGAAGAGTTTGGAGGG + Intergenic
1057817706 9:98307744-98307766 GTGTGGATGAAATGGGAGGATGG + Intronic
1057952817 9:99383604-99383626 GTGTGAATGGAGGGGTAGGAGGG - Intergenic
1058879094 9:109271240-109271262 CTGTGGCTGAGCAGGAAGGATGG - Intronic
1059336821 9:113574375-113574397 CTGTGGAAGTAGAGGCAGCAGGG - Intronic
1060676576 9:125520740-125520762 CTTTGGAGGAAGAGGTAGGATGG - Intronic
1060712495 9:125882120-125882142 CTATGGAGGATGAGGTGGGAGGG + Intronic
1060924467 9:127446431-127446453 CTTAGGATGCTGAGGTAGGAGGG - Intergenic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061489010 9:130934832-130934854 GTGTGGCTGAGGAGGTAGAATGG - Intronic
1186521732 X:10212470-10212492 CTGGGGATGAAGAGGCCCGACGG - Exonic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187097709 X:16164981-16165003 GGGTGGAGGAAGAGGAAGGAAGG - Intergenic
1187421594 X:19139052-19139074 CTGGGGATGAAGAGGTAACCAGG + Intergenic
1188230409 X:27656080-27656102 TTGTGGAAGAATATGTAGGAGGG + Intronic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189338759 X:40188004-40188026 CTCTGGAGGATGAGGTGGGAGGG - Intergenic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1194538269 X:95135665-95135687 CTGTTGGTGAAGCTGTAGGAAGG + Intergenic
1194640055 X:96392915-96392937 CTGAGTATGAAGCAGTAGGAGGG + Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195296751 X:103486091-103486113 CTGTGGCTGAATAGGAATGAAGG + Intergenic
1196302914 X:114066946-114066968 CTGGCGTTGAAGAGGGAGGAAGG + Intergenic
1198810782 X:140534176-140534198 AGGTGGAAGAAGAGGAAGGAGGG + Intergenic
1199614100 X:149641640-149641662 CAGAGGAGGAAGAGGTAGGAGGG + Intergenic
1199867039 X:151861085-151861107 CTGTGCATGAAGAGAAATGAAGG - Intergenic
1199868054 X:151872084-151872106 TTGAGGGTGAAGAGGTAGGAAGG + Intergenic
1200941654 Y:8788378-8788400 CTGTGGCTGAAGAGGGATAATGG - Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic