ID: 1113174538

View in Genome Browser
Species Human (GRCh38)
Location 13:107547184-107547206
Sequence TATGAGGCACTCTTCTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113174538_1113174541 17 Left 1113174538 13:107547184-107547206 CCACATCAGAAGAGTGCCTCATA 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1113174541 13:107547224-107547246 TCTAATATTTCTGTGACAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 261
1113174538_1113174540 16 Left 1113174538 13:107547184-107547206 CCACATCAGAAGAGTGCCTCATA 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1113174540 13:107547223-107547245 TTCTAATATTTCTGTGACAGAGG 0: 1
1: 0
2: 1
3: 24
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113174538 Original CRISPR TATGAGGCACTCTTCTGATG TGG (reversed) Intronic
902579483 1:17399138-17399160 TGTGAGGCCCACTTCGGATGGGG + Intronic
906431289 1:45757782-45757804 GATGAGGGACACTTATGATGAGG + Intergenic
907699903 1:56775978-56776000 TATGAGGCATTCTACAGTTGAGG + Intronic
911218098 1:95217160-95217182 GAGGAGGAACTCTTCTGATATGG - Intronic
915235784 1:154480391-154480413 TGTGAGGCATTCTTCAGTTGCGG - Exonic
916143743 1:161722364-161722386 TATGGGGCTCTCTTGTGCTGTGG + Intronic
919225139 1:194688193-194688215 TATGAGCCATTTTTCAGATGAGG - Intergenic
921538904 1:216387879-216387901 TATGAGGCAAAATTCTGGTGTGG + Intronic
922977628 1:229798532-229798554 TATGAGGCACTCTCAAGATTTGG - Intergenic
1066148470 10:32588133-32588155 AAGGAGGCACTCCTCCGATGTGG + Intronic
1067421185 10:46150176-46150198 TCTGAAGCACACTTCTGTTGTGG + Intergenic
1067491034 10:46702831-46702853 TCTGAAGCACACTTCTGTTGTGG + Intergenic
1067506522 10:46856631-46856653 TCTGAAGCACACTTCTGTTGTGG + Intergenic
1067603629 10:47637535-47637557 TCTGAAGCACACTTCTGTTGTGG - Intergenic
1070267723 10:74920506-74920528 CTGGAGGCACTCTTCTAATGAGG - Intronic
1073273401 10:102286956-102286978 TGTGTTGGACTCTTCTGATGGGG + Intronic
1073603585 10:104870858-104870880 TCTGAGGCATTCTTCTGACTAGG + Intronic
1076480442 10:130781745-130781767 TAGGATGCACACTTGTGATGGGG - Intergenic
1077755148 11:5020410-5020432 TATGAGGCAATATTTTGCTGTGG + Intergenic
1080627216 11:34041504-34041526 TATGAAGCACTCAGCTGATGAGG - Intergenic
1081403077 11:42665338-42665360 AAGGAGGCTCTCTTCAGATGAGG - Intergenic
1082756556 11:57082402-57082424 TATGAGACAGTCGTGTGATGAGG + Intergenic
1084633687 11:70375327-70375349 TATATGTCACTCTTCTGATCAGG - Intronic
1091592816 12:1855323-1855345 TGGGAGGCAGTCTTCTTATGCGG + Intronic
1091761997 12:3093588-3093610 TGTCAGGCACTCTTCTAATGGGG - Intronic
1091862648 12:3800381-3800403 TATGAGGCAGATTTCAGATGTGG + Intronic
1096490836 12:52012029-52012051 CATGAGGCCCTCACCTGATGCGG - Intronic
1098994446 12:77102672-77102694 TATGAAGAACTCATCTGATGGGG - Intergenic
1099781367 12:87200109-87200131 TGTCAGGCACTCTTCTGGAGTGG - Intergenic
1101346613 12:103891838-103891860 TATGTGGCTCCCGTCTGATGGGG - Intergenic
1102262616 12:111453671-111453693 TATGACGCACCCTTCAGGTGAGG - Exonic
1104296350 12:127518159-127518181 TAAGTGGCACACTTCTGAAGTGG - Intergenic
1109094447 13:58095588-58095610 TAAGAGGCACTCTTTTGTCGTGG - Intergenic
1113174538 13:107547184-107547206 TATGAGGCACTCTTCTGATGTGG - Intronic
1114219836 14:20686240-20686262 CATGAGGCACTCTAGTAATGTGG + Intronic
1115598035 14:34928034-34928056 TATAAGGCAGTCTTCTGGGGTGG + Intergenic
1127655244 15:61049344-61049366 CATGAGGCTCGTTTCTGATGAGG + Intronic
1130320831 15:82839208-82839230 TATGAGGCACTTTTCTTCTGTGG - Intronic
1135238048 16:20776889-20776911 TAAGAGGCACTCAGCTGATGTGG + Intronic
1136452337 16:30360384-30360406 TAAGGGGCTCTTTTCTGATGTGG - Intronic
1141239219 16:82249564-82249586 GATGCAGAACTCTTCTGATGAGG - Intergenic
1150028864 17:61709941-61709963 TCTGAGGCACTCTTCTTGTAAGG - Intronic
1153726781 18:7964925-7964947 TATGAGACACTGTTATGCTGTGG + Intronic
1163861753 19:19746631-19746653 TGTGATGCCCTCTGCTGATGGGG - Intergenic
1166379657 19:42349381-42349403 TCTGAGGCCCTCTTCTTAGGAGG + Intronic
927308970 2:21606810-21606832 TATAAGGAACTCTCCAGATGTGG + Intergenic
929700834 2:44161630-44161652 TATGAGGAACTATTCTTACGAGG + Intergenic
930704502 2:54490865-54490887 TTTGAGGACCTCTTCTGCTGTGG + Intronic
935428442 2:102946232-102946254 TATGAGGAAGCCTTCTGTTGGGG + Intergenic
936607908 2:113976245-113976267 GATGGGGCCGTCTTCTGATGGGG - Intergenic
937143910 2:119626260-119626282 TAAAAGGCACTCTGCAGATGGGG - Intronic
937511136 2:122596112-122596134 TATGAGGCATTCTTGTGGTGAGG - Intergenic
943156547 2:184186817-184186839 TATAAGGCAGTCTCCTGATAAGG + Intergenic
946710650 2:222501610-222501632 TATGAGGAAGTCTCCTGATGAGG - Intronic
947960210 2:234230073-234230095 TATGTGGCTCTCTTCTGTAGTGG + Intergenic
1170138013 20:13096678-13096700 TCTGGGGCAATCTTTTGATGGGG + Intronic
1173119695 20:40277437-40277459 TCTCAGGAACTCTTATGATGAGG - Intergenic
1174484787 20:50854342-50854364 TATGTAGCAGTATTCTGATGTGG + Intronic
1175765785 20:61591852-61591874 AATGAAGGACTTTTCTGATGAGG - Intronic
1178028491 21:28495958-28495980 TATGAGGCCTTCTGCTTATGAGG + Intergenic
1178526633 21:33335196-33335218 GATGAGTCACTCTTATGATGAGG - Intronic
1181375788 22:22456975-22456997 TTTGAGGCACACTGATGATGAGG - Intergenic
951650156 3:24942399-24942421 AATGAGGCCCTCATCTGAAGAGG + Intergenic
955101627 3:55855244-55855266 TCTGAGACACTCTTGTGATGGGG - Intronic
957165484 3:76668021-76668043 TATCAGACACTCTACTGCTGTGG + Intronic
962905310 3:139796091-139796113 CAGGAGGCACTTTCCTGATGAGG + Intergenic
966363483 3:179155170-179155192 TATAAGGCACTATTATGAAGAGG + Intronic
970875337 4:20862590-20862612 TTTGAGGCACTCCTTTGATAGGG - Intronic
972722081 4:41710038-41710060 TATGACTCACTCTTAAGATGAGG - Intergenic
977159949 4:93621454-93621476 TATGAAGGACTCTGCTGGTGTGG + Intronic
979822262 4:125189611-125189633 TATTTGACACTCTTCTGATTAGG - Intergenic
983523998 4:168741776-168741798 CATGAGTGCCTCTTCTGATGAGG + Intronic
987999174 5:25328340-25328362 TATGAGTCACTCCTCTGTTTAGG + Intergenic
989012860 5:36893143-36893165 GAAGAGGCAGTCTTCAGATGAGG - Intronic
991444898 5:66688972-66688994 TTTGAGGTTCTATTCTGATGAGG - Intronic
992085980 5:73278834-73278856 AGTGAGGCACTCCTCAGATGTGG - Intergenic
992154388 5:73940403-73940425 TATTTGGCACTTTACTGATGTGG - Intronic
992834085 5:80623090-80623112 TAGGATGCACTCTTTTGATCTGG - Intergenic
993986502 5:94603508-94603530 TATTATGCACACTTCTTATGTGG - Intronic
995365132 5:111351116-111351138 TATTAGGCATTCTTCAAATGTGG + Intronic
995978647 5:118074502-118074524 GTTGAGTCACTCTTCTGTTGTGG - Intergenic
996428629 5:123344307-123344329 TATTAGGGCCTCTGCTGATGGGG - Intergenic
996919638 5:128752675-128752697 TAAAATGGACTCTTCTGATGGGG - Intronic
997063449 5:130534773-130534795 TATCAGGCACTGTTCTGGTTTGG + Intergenic
997326324 5:133024989-133025011 TTTGAGGAACTCTTCTTATCAGG + Intronic
997947108 5:138212697-138212719 TATGAGGCACTCTTATGTCTAGG + Intronic
999508717 5:152225444-152225466 ATTGAGGACCTCTTCTGATGGGG + Intergenic
999540612 5:152568049-152568071 TTTGAGGCTCTCTTGTGATTTGG + Intergenic
1001013994 5:168124318-168124340 TATGAGTCACTTTCCTAATGAGG - Intronic
1002303553 5:178270738-178270760 TTAGAGGCTTTCTTCTGATGGGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1006960725 6:37927387-37927409 AATCAGGCGCCCTTCTGATGCGG - Intronic
1007903237 6:45431519-45431541 TATGATGCAATCTGCAGATGGGG + Intronic
1007923019 6:45627809-45627831 TATGAGGGACCCTAGTGATGAGG + Intronic
1019096567 6:169586123-169586145 TTTGAAGCACTCCTCTGGTGTGG + Intronic
1020067231 7:5197954-5197976 GGAGAGGCACTTTTCTGATGAGG + Intronic
1020841811 7:13227225-13227247 TAAGAGGCACTCGTCTGTAGGGG + Intergenic
1022908338 7:34877185-34877207 GATGAGCCACAATTCTGATGGGG + Intronic
1028518549 7:91703893-91703915 TATGAGTCACTCATTTTATGAGG + Intronic
1030644349 7:112043008-112043030 CATGAGGCCCTCACCTGATGTGG + Intronic
1031185793 7:118478338-118478360 TATGAGGCACTCTTGTCCTGTGG - Intergenic
1032175995 7:129626421-129626443 AATGAGCCAATCTTATGATGTGG - Intronic
1032424398 7:131810010-131810032 TATGAGGCAATAATATGATGTGG - Intergenic
1034094429 7:148393718-148393740 TATGATGCACTGTTTTGGTGAGG - Intronic
1036211129 8:6842082-6842104 TCTGAGGCACTCTTCTGCTTGGG + Intergenic
1036988704 8:13567063-13567085 TTTGAAGAACTCTACTGATGAGG + Exonic
1037332188 8:17754186-17754208 GATGAGGCACTGGTCTGCTGAGG + Exonic
1037971147 8:23172828-23172850 TATGGGGCACTCATCTGAGGTGG + Intergenic
1039610983 8:38919166-38919188 TCTGAGGCTCTCTTCTCATCTGG - Intronic
1043301618 8:78741861-78741883 TCTGAGCCATTCTTCTGATAGGG - Intronic
1044095863 8:88063605-88063627 TATCAGCCACTTTTCTGATCCGG - Intronic
1044408389 8:91857125-91857147 TATGAGGCATTTTTCTCATTAGG + Intergenic
1045375143 8:101564928-101564950 TATTAGGCACTGTGGTGATGTGG + Intronic
1046082309 8:109385625-109385647 TTTGAGGTAATCTTTTGATGTGG + Exonic
1046975196 8:120267255-120267277 GATGAGGAACTGTTGTGATGAGG - Intronic
1052033961 9:23659418-23659440 TTTGAGGCACTCTGCCAATGTGG - Intergenic
1054744653 9:68842484-68842506 TATGAGACACTCCATTGATGTGG + Intronic
1056299317 9:85225653-85225675 TATGAGGCCCTCTGAAGATGAGG + Intergenic
1187287226 X:17917184-17917206 TAACAGGCAGTCTTCTAATGGGG - Intergenic
1188633913 X:32404377-32404399 TATGAGGCACTCTTCTTTGAAGG + Intronic
1193537731 X:82734102-82734124 GAAGAGGCTCTCTTCTGATGCGG - Intergenic
1194618264 X:96135014-96135036 CATTAATCACTCTTCTGATGTGG - Intergenic
1195112596 X:101662480-101662502 TATCAGGAGCTCTTCTGATCTGG - Intergenic
1197220368 X:123906509-123906531 TTTGAGGGACACTTCTGAAGTGG - Intronic