ID: 1113178364

View in Genome Browser
Species Human (GRCh38)
Location 13:107594955-107594977
Sequence CTATGGATCTGAAAGTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113178364 Original CRISPR CTATGGATCTGAAAGTGTAC AGG (reversed) Intronic
905065675 1:35179679-35179701 CTAATCATCTGAAAGTGAACAGG + Intronic
905877348 1:41441061-41441083 CTATGGATCTGAGACTGGGCGGG - Intergenic
907594903 1:55710813-55710835 GTAAGGATCTGAAAGTCTATAGG - Intergenic
907669153 1:56459524-56459546 CTTAGGATCTGACAGTGTATTGG - Intergenic
908736895 1:67285943-67285965 TTATGGTTGTGAAAGTGTAAAGG - Intergenic
916448589 1:164896736-164896758 CTCTGGTTCCCAAAGTGTACAGG - Intronic
916953652 1:169809034-169809056 CTATGGGGGTGAAAGTGTAGGGG + Intronic
920875005 1:209826704-209826726 CTAGGGATTTGCAAGTGTGCAGG - Intergenic
920905286 1:210158335-210158357 CTGTGAATCTGAAAGTCTTCTGG - Intronic
1066510785 10:36093288-36093310 CTATGAATCTGAAGTTCTACAGG + Intergenic
1068131792 10:52904478-52904500 ATCTTGATCTGAAAGTGCACAGG - Intergenic
1068408323 10:56622859-56622881 CTGTGGTTCTGAAATTGTACTGG + Intergenic
1074259671 10:111839232-111839254 CTATGGATCAGAACCTGGACCGG - Intergenic
1078411861 11:11129147-11129169 CTATGGGGCTGAAATGGTACAGG + Intergenic
1081474633 11:43414887-43414909 CTATGCATCTGGAATTATACTGG - Intronic
1084294566 11:68203273-68203295 CTAATGATATGAAAGTGTATGGG - Intronic
1085564526 11:77501253-77501275 CTATGGATGTGAAACTCTCCTGG - Intergenic
1089181966 11:116589535-116589557 CTATGGCTCTGAGAGTGCTCAGG - Intergenic
1103686182 12:122733902-122733924 CTATTCCTCTGAAAGTCTACTGG + Intergenic
1113178364 13:107594955-107594977 CTATGGATCTGAAAGTGTACAGG - Intronic
1113757775 13:112825767-112825789 CTTTGGATCTGGAAAGGTACAGG + Intronic
1116618575 14:47170391-47170413 CTATGTGTCTGAAACTGTACAGG + Intronic
1120745215 14:88146066-88146088 CTATGGATCTAAGTGTGGACAGG + Intergenic
1121423793 14:93833894-93833916 GAATGGTTCTGAAAGTGTCCCGG - Intergenic
1126763160 15:51988140-51988162 CTATGGGTCTGAAATTGTTTAGG - Intronic
1130039869 15:80397489-80397511 CTATGGAGGTAAAAGTGGACAGG + Intronic
1135743528 16:24997091-24997113 ATATGCATCTGGATGTGTACTGG - Intronic
1136360516 16:29776347-29776369 CTAAGGATCCGAAGGTCTACAGG - Intergenic
1144655975 17:17036921-17036943 CTCTGGTTCTGAGAGTGGACTGG - Intergenic
1149558270 17:57589689-57589711 CTTTGGATCAGTAAGTGTTCAGG - Intronic
930228635 2:48821105-48821127 CTCTTGATCTGTAAGTTTACCGG + Intergenic
931755616 2:65371619-65371641 CTATGTTTCTTAAAGTGTAACGG + Intronic
936225915 2:110651186-110651208 CTATATATATGGAAGTGTACTGG - Intronic
937721088 2:125097173-125097195 TTAAAGATCTGAGAGTGTACAGG + Intergenic
940898131 2:159100893-159100915 ATATGGTTGTGAATGTGTACTGG + Intronic
942503893 2:176621351-176621373 TGATGGATCTGAAACAGTACAGG - Intergenic
946202926 2:218081510-218081532 CTATGGATCTTACAGTGTTTGGG - Intronic
1173912804 20:46682885-46682907 CAAGGGATCTGAAAGTGCAGAGG + Intronic
1175453435 20:59090568-59090590 CTATGTATCTAAGAGTGTAATGG + Intergenic
1178350955 21:31873021-31873043 CTAGGGATTTGAAAGTGCACGGG + Intergenic
1181881442 22:25983560-25983582 GAGTGGATCTGAAAGTGAACAGG - Intronic
1184626973 22:45742587-45742609 TGATGTATCTTAAAGTGTACTGG - Intronic
949825139 3:8157143-8157165 CCATGGATATGAAAGTGCCCAGG + Intergenic
953742983 3:45552794-45552816 CTATGGATCTCACAGTGTAAAGG - Intergenic
953819227 3:46189884-46189906 CTATGGTTCTCAAACTGTAGGGG - Intronic
960737745 3:120799120-120799142 CTAGGAATCTGAATGTTTACAGG + Intergenic
964385341 3:156141371-156141393 CTATGGCTATAAAAGTGTAGAGG - Intronic
966699307 3:182828391-182828413 CAATTGATCTTAAAGTTTACAGG - Intronic
969263693 4:6050309-6050331 CTAAGGCTCTGAAAGTTTACAGG + Intronic
971702616 4:29998113-29998135 CTATGTATCTGTATGTGTGCTGG + Intergenic
971949536 4:33327270-33327292 CTATGGGTCTGAATGTATAATGG - Intergenic
974961993 4:68714069-68714091 TTTAGGATCTGAAAGTATACCGG - Intergenic
979108161 4:116714367-116714389 CAATTTATATGAAAGTGTACTGG + Intergenic
980456870 4:133055513-133055535 CTATGGATGTGTAAGGGTAAAGG + Intergenic
982215381 4:153078966-153078988 CAATGGATCTGAATCTGTGCTGG - Intergenic
988121607 5:26970944-26970966 CTATGGATCAGAAAATTTAGAGG - Intronic
990386593 5:55270041-55270063 CTAAACATCTGACAGTGTACAGG - Intronic
993511941 5:88781591-88781613 ATATGGATGTGAAAGTGTAAGGG + Intronic
998043805 5:138970498-138970520 CTATGGAAAAGAGAGTGTACTGG + Intronic
999333882 5:150698460-150698482 CAATAAATCTGAAAGTGTGCAGG - Intronic
1000231927 5:159323670-159323692 CTATGAAACTGAAATTGTGCTGG - Intronic
1001383908 5:171322274-171322296 TCCTGGATCTGAAAGTATACCGG + Intergenic
1005067796 6:21835392-21835414 CTATATGTCTGAAAGTGTATGGG - Intergenic
1005163961 6:22897803-22897825 TTATGGATCTTAAAATGGACAGG + Intergenic
1006331474 6:33394117-33394139 CTAGGCATCTGACAGTGTACAGG + Intronic
1009761300 6:68010242-68010264 CTAAGGACCTGGAAGTGTACTGG + Intergenic
1013413521 6:109903803-109903825 CTATGTGACTAAAAGTGTACTGG - Intergenic
1020770202 7:12381339-12381361 CTGGGGATCTGAAAGTTTTCTGG + Intronic
1023216241 7:37866106-37866128 CTGTGTATTAGAAAGTGTACTGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1028680739 7:93528164-93528186 CAATGGGCCTGAAAGTGTTCAGG - Intronic
1028768581 7:94589105-94589127 ATCTGGATCTGAAAGTGTATAGG - Intronic
1029471967 7:100760314-100760336 CTATGGAAATGAAAGTCTGCTGG + Intronic
1035209007 7:157314067-157314089 CTCTGAATCAGAAAGTGAACTGG + Intergenic
1036153349 8:6319414-6319436 CTATGGATCTAAAATTGCAATGG + Intergenic
1037928994 8:22866040-22866062 CTCTGGCTCTGAAAGGGGACAGG - Intronic
1042671642 8:71270552-71270574 CTATGTATATGAATATGTACTGG - Intronic
1043436317 8:80239241-80239263 CTATGTATCTGAAATAGTGCTGG - Intergenic
1045407738 8:101883824-101883846 CCATGGATCTGAAATTCTAGTGG - Intronic
1049236541 8:141515043-141515065 CTATGGACCTGGAGGTGTGCAGG + Intronic
1051483464 9:17584033-17584055 CTAAGAATGTGAAAGGGTACAGG - Intronic
1056623317 9:88233507-88233529 CAATGGATTTGAAGATGTACAGG - Intergenic
1056767187 9:89452048-89452070 CTATGGATCTGAGTGTGTTGAGG + Intronic
1057724969 9:97562002-97562024 TCATGGAGCTGAAAGTGTGCTGG - Intronic
1057743737 9:97734921-97734943 CTCTGGATCTGAAAGAGCCCTGG - Intergenic
1185480165 X:440018-440040 CTGTGGGTGTGAACGTGTACAGG - Intergenic
1185480182 X:440250-440272 CTGTGGGTGTGAACGTGTACAGG - Intergenic
1187642494 X:21310202-21310224 CTATGGCTCAGAGAGTGTAAAGG - Intergenic
1192243932 X:69357938-69357960 CTGTGGAGCTGAAATTGTCCTGG - Intergenic
1194224327 X:91237004-91237026 CTTTGAATCTGAACGTGTAAAGG + Intergenic
1196697858 X:118633336-118633358 TCATGTATCTGAAAGTTTACTGG - Intronic
1199294495 X:146141759-146141781 ATAGGCATCTGAAAGGGTACAGG - Intergenic