ID: 1113183445

View in Genome Browser
Species Human (GRCh38)
Location 13:107658742-107658764
Sequence AAGAAGTGATGAGTGGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113183445 Original CRISPR AAGAAGTGATGAGTGGGTCA AGG (reversed) Intronic
901341116 1:8500381-8500403 AAGAATTGATGAGTTGGAGACGG + Intronic
903884829 1:26535147-26535169 GAGAAGGGATGGGTTGGTCAGGG - Intronic
904002422 1:27346272-27346294 TAGAAGTGAAGAGTGGGTTCAGG - Intronic
904079539 1:27863298-27863320 AGGAAGTCATGGGTGAGTCAAGG - Intergenic
905434867 1:37949271-37949293 AGAAAGTGTTAAGTGGGTCATGG + Intergenic
905521754 1:38605763-38605785 AGGAGGTGGTGAGTGGGGCAGGG - Intergenic
906154172 1:43604425-43604447 CAAAAGAGATCAGTGGGTCAAGG - Intronic
907054230 1:51350173-51350195 AAGAACTGTTGCGTGGGCCAGGG - Intergenic
909027123 1:70494916-70494938 AAGAAGTAATCAATGGCTCATGG - Intergenic
911028473 1:93460169-93460191 AAGAAGTGATTAGTCTGTAAGGG + Intronic
911800936 1:102136904-102136926 AATATGTGATGTGTGGGTAAGGG + Intergenic
915218544 1:154355901-154355923 AAGGAGTGGAGAGTGGGACATGG - Intergenic
916889788 1:169104670-169104692 AAAAAGAGATGAGTGGGGAAAGG - Intergenic
917127971 1:171707934-171707956 GAGAAGGGGTGAGTGGCTCATGG + Intronic
917508405 1:175649622-175649644 AAGAAGTGATGCCTGGGTGAAGG - Intronic
918811155 1:189122734-189122756 AAGAGGTGAGGAGTGGGCAAGGG + Intergenic
920951198 1:210573270-210573292 ATGTAGGGATGAGTGAGTCAGGG - Intronic
921262220 1:213394482-213394504 AAGCAGTGCTGAGTGGCTGAAGG - Intergenic
921426876 1:215013160-215013182 AAGATATGAGGTGTGGGTCAAGG + Intronic
923947831 1:238909723-238909745 AAGAACTGACAAGTGGGTGAAGG + Intergenic
924071598 1:240285789-240285811 AAGACTTGATGAGTGGGTTTAGG + Intronic
924669701 1:246111069-246111091 AAGATGTTATGCATGGGTCAGGG - Intronic
924752325 1:246905766-246905788 AATAAGTGATCTGTGGGCCATGG + Intronic
1063078405 10:2739965-2739987 AGGAAATCATGAGTGGCTCAGGG - Intergenic
1063269421 10:4489681-4489703 CAGTAATGATGACTGGGTCAAGG + Intergenic
1063733616 10:8726566-8726588 AAGAAATTATGATTGTGTCATGG + Intergenic
1063883428 10:10553673-10553695 CAGAAGTGATGACTGAGCCAGGG + Intergenic
1064786888 10:18907695-18907717 AGGAAGGAATGAGTGAGTCAGGG + Intergenic
1067216252 10:44306599-44306621 AAGAATTGGAGAGTGGGGCAAGG + Intergenic
1068312507 10:55296100-55296122 AATAAGTGATGCATGGGGCAAGG + Intronic
1069383775 10:67865727-67865749 ATGAAATTATGAGTGGGCCATGG - Intergenic
1070648828 10:78220457-78220479 AAGAAGGGATGAGTGGTGCCAGG + Intergenic
1071907937 10:90195725-90195747 AAAAAGTGATGACTGTGCCATGG - Intergenic
1072448158 10:95517374-95517396 AAGGTGTGAGGAGTGGGTGAGGG - Intronic
1073798147 10:107011272-107011294 AAGAAGTGAAAAGTGGTTTAAGG - Intronic
1075138613 10:119810690-119810712 AAAAAATGATGAGTTGGTTAGGG - Intronic
1076888760 10:133274144-133274166 AAGAACAGGTGAGTGGGTCTCGG - Exonic
1080296572 11:30736632-30736654 GGGAAGTGAGGGGTGGGTCAGGG + Intergenic
1080300903 11:30784063-30784085 AAGATGGGTTGAGAGGGTCAAGG + Intergenic
1080382984 11:31793375-31793397 GAGAAGTGAGGAGTGGCTCAGGG - Intronic
1083423786 11:62572218-62572240 ATGAAGTGCTGTGTGGGTCTGGG - Intronic
1084106465 11:66984011-66984033 AAGAAGTCTTGAATGGGGCAGGG - Intergenic
1085410228 11:76286444-76286466 CAGAAGTGATGAGCTGGTCTTGG - Intergenic
1085956609 11:81405410-81405432 AAGGAGAGATGTTTGGGTCATGG + Intergenic
1086240097 11:84680061-84680083 AAGAAGTGAAGAGTTGGAAATGG - Intronic
1087968912 11:104454690-104454712 AACAGGAGATGGGTGGGTCATGG - Intergenic
1088366142 11:109041809-109041831 AAGAAGGGAAGAGTGGGTCCTGG - Intergenic
1089656700 11:119952509-119952531 AGGATGTAAGGAGTGGGTCATGG + Intergenic
1089992598 11:122875621-122875643 AAGAAGGAATTAGTGGGGCATGG + Intergenic
1094443745 12:30507556-30507578 ATGAAGAGATGCGTGGGGCAAGG + Intergenic
1096673843 12:53215804-53215826 AAGCAGTGATGTGAGGGTCAGGG + Intronic
1097399367 12:59110202-59110224 AAGGACTGTTGAGTGGGACAAGG + Intergenic
1098036883 12:66312410-66312432 AAGATATGATAAGTGGCTCATGG - Intronic
1099098977 12:78412880-78412902 AAGAAGTAATGACTGAGTCCTGG - Intergenic
1099571469 12:84324828-84324850 TAGAAGTGCTGAGTGAGTCATGG - Intergenic
1099624890 12:85058880-85058902 AAGAAGGGATGAGAGGATTATGG - Intronic
1100036804 12:90261641-90261663 AAGTAGAGAAGAGTAGGTCAGGG - Intergenic
1100647377 12:96545607-96545629 CATAAGAGATGACTGGGTCACGG - Intronic
1101425346 12:104583600-104583622 AAGAAGTGCTGAAGGGGTAAGGG - Intronic
1102052845 12:109875620-109875642 AAGATCTGATTACTGGGTCAAGG + Intronic
1103055150 12:117813881-117813903 AAGAAGAGATGAATGGATAAAGG + Intronic
1103644560 12:122380778-122380800 CAGATGTGAGGAGTGGGTCATGG - Intronic
1104314036 12:127680474-127680496 ACTAAGTGATGTGTGGGCCAAGG - Intergenic
1104878120 12:132050908-132050930 CAGATGTGATGAGTGTGCCAGGG + Intronic
1106727256 13:32498635-32498657 AAGAAGTGATTACTAGGTCCGGG - Intronic
1107117701 13:36764849-36764871 ATGAAGTTTTGAGTGGGGCACGG - Intergenic
1107391358 13:39967910-39967932 AACAAGAGATGAGGGGGTAAAGG - Intergenic
1108475071 13:50807884-50807906 AAGGACTGACCAGTGGGTCACGG + Intronic
1108578195 13:51807081-51807103 AAGAAGTGGGGGGCGGGTCATGG + Intergenic
1110107451 13:71695618-71695640 CAGAAATGATGAGTGTGTCCAGG + Intronic
1111554585 13:89863677-89863699 AAGGAGTAATGAGGAGGTCATGG - Intergenic
1111607183 13:90555611-90555633 AGGAAAATATGAGTGGGTCAAGG + Intergenic
1112071117 13:95851420-95851442 ATGGAGTGAGAAGTGGGTCAAGG + Intronic
1112074388 13:95894120-95894142 AAGGAGTGAAGAGAGGGTCAAGG - Intronic
1113183445 13:107658742-107658764 AAGAAGTGATGAGTGGGTCAAGG - Intronic
1113312359 13:109143258-109143280 AACAAGTGAAAAGTAGGTCAAGG + Intronic
1113359026 13:109611025-109611047 AAGAATTGATGATGTGGTCAGGG + Intergenic
1114517887 14:23311806-23311828 ATGAAGAGATGATTGGATCAAGG - Intronic
1114647035 14:24261584-24261606 CAGAGGTGAGGAGTGGGGCAGGG + Intronic
1115147796 14:30246165-30246187 GAGAGGTGATGAGTGAGACATGG + Intergenic
1115882385 14:37934100-37934122 AGGAAATGATGAATGGGTCCAGG + Intronic
1116805635 14:49491632-49491654 AAGAAGTCATGAGAGGGTGAGGG - Intergenic
1117695586 14:58359129-58359151 AAGGTATGATGAGTGGGTGAAGG + Exonic
1118122773 14:62864530-62864552 AAGAAAAGATGAGTTGGTCAAGG + Intronic
1119302184 14:73580114-73580136 ACAAAGTGATGGGTGGGGCAGGG + Intergenic
1121441417 14:93952053-93952075 GAGGAGTGAGGAATGGGTCAGGG + Intronic
1121692270 14:95886369-95886391 AAGAAGGGAAGAGTGTCTCAGGG + Intergenic
1121857569 14:97284019-97284041 AAGAAGTGGTGATTGGGTCTTGG - Intergenic
1122006402 14:98707545-98707567 AAGAAGTGGCGAGTGGATCTTGG + Intergenic
1124480032 15:30070520-30070542 AAGAAATGAAGAGTGGGGGAGGG - Intergenic
1127828522 15:62727895-62727917 AAGAGGGGAGGAGTGGGTTATGG + Intronic
1130088297 15:80796987-80797009 AAGGAGCTATGAGTGGCTCAGGG + Intronic
1130551324 15:84891523-84891545 ATGAATTGAGAAGTGGGTCAAGG + Intronic
1130718663 15:86363831-86363853 AGGAAGAGCTGAGTGGGGCAGGG - Intronic
1131581895 15:93651480-93651502 ACCAAGTGATGAGAGGGTCAAGG + Intergenic
1132145856 15:99429478-99429500 AACAAGTGATGAGTATGTGAGGG + Intergenic
1132411187 15:101579291-101579313 AAGAAGTGGGGAGGGGGGCAGGG - Intergenic
1132751328 16:1459200-1459222 AAGCACGGCTGAGTGGGTCACGG + Intronic
1137441876 16:48504893-48504915 AAGAGGTGCTGACTGAGTCAGGG + Intergenic
1137798077 16:51238736-51238758 GAGAAGTGAAGAGGTGGTCAGGG - Intergenic
1137876558 16:52002254-52002276 AATAAGTAATGAGTGTGCCAAGG - Intergenic
1138527845 16:57619379-57619401 AAGGAGTGAAGGGTGGGACAGGG + Intronic
1138644939 16:58417877-58417899 AACAGGTGATGGGTGGCTCATGG + Intergenic
1141205847 16:81932666-81932688 CAGAAGAGTTGAGTGAGTCAAGG - Intronic
1142270830 16:89088562-89088584 AGGGAGTGGTGATTGGGTCAGGG + Intronic
1145211695 17:21018032-21018054 CAGAAGTGGCGTGTGGGTCAGGG + Exonic
1146510548 17:33444418-33444440 AAATAGTGAGGAGTGAGTCAGGG + Intronic
1147181282 17:38687364-38687386 AAGAAGACATGAGTGGCTGAAGG - Intergenic
1148359698 17:47001416-47001438 AGGAAGTCATGAGTGGAGCATGG - Intronic
1149063661 17:52454726-52454748 AAGAAGTGAGGAATAAGTCATGG + Intergenic
1149650790 17:58275185-58275207 AAGAAGAGGTGAGTGGGTAAAGG + Intronic
1150787153 17:68172472-68172494 AGGAAGTCATGAGTGGAGCATGG + Intergenic
1152602406 17:81271043-81271065 AGGAAGGGATGAGTGGGGAAGGG + Intronic
1153478338 18:5520968-5520990 AAGGAGTGGTGTGTGGGTTATGG - Intronic
1156585367 18:38425838-38425860 CAGAAGTGGGGATTGGGTCAGGG - Intergenic
1159235195 18:65662637-65662659 AATAAGTGAAGAGGGGGTCTAGG - Intergenic
1159676507 18:71289901-71289923 TAAAAATGTTGAGTGGGTCAAGG + Intergenic
1160270937 18:77382870-77382892 GAGCAGTGATGATGGGGTCAGGG + Intergenic
1162013487 19:7831347-7831369 CAGAAGTGTTGAGTGGGTGGGGG - Intronic
1163196031 19:15720926-15720948 TAGGAGTGAGGAGTGGCTCAAGG - Intergenic
1163211765 19:15846001-15846023 AAGGAGTGGGGAGTGGCTCATGG + Intergenic
1164660775 19:29965027-29965049 AAGAAGTCAGGAGGGAGTCAAGG + Intronic
1164974124 19:32559062-32559084 AAGAATTCAAGAGTGAGTCAGGG - Intergenic
1166416669 19:42600296-42600318 AACAAGTGAACACTGGGTCAAGG - Intronic
1166929385 19:46292656-46292678 AAGAAGAGATGCCTGGGCCAGGG - Intergenic
1167605949 19:50481327-50481349 AAGGAGAGAGGAGTGGGTCCGGG + Intronic
1167716616 19:51146303-51146325 AAGAGGGGAGGAGTGGGTCTTGG + Intronic
1168061737 19:53896942-53896964 ATGAAGTGATGCTTGAGTCAAGG + Intronic
926316914 2:11716525-11716547 ACACAGTGATGAGTGTGTCATGG + Intronic
926569601 2:14515103-14515125 AAGAAGAGATGAGGGGCTGAGGG + Intergenic
927446070 2:23162561-23162583 AAAAAGAGGTGATTGGGTCATGG + Intergenic
927490710 2:23519237-23519259 AAGAAGTCATGGGTGGATGACGG - Intronic
927878389 2:26673956-26673978 AAGAGGTGATTAGTGGGGTAGGG + Intergenic
929417267 2:41756060-41756082 AAGAAGTGGTGAGTGTGTGCTGG + Intergenic
929423867 2:41823913-41823935 AAGATGTGAGGATTAGGTCAAGG - Intergenic
929666827 2:43839829-43839851 ATGAAGTGATGGGTGAGACAGGG + Intronic
930275527 2:49306237-49306259 AAGAAATGGTGAGAGGCTCATGG + Intergenic
930601025 2:53443261-53443283 AAGAAATGATCAGAGCGTCAAGG - Intergenic
932354691 2:71059077-71059099 CAGAAGTGATGAGCGGCTCCAGG + Intergenic
932375197 2:71229042-71229064 AAGAAGTGAAGAGTGGGAAGGGG + Intergenic
934613074 2:95755024-95755046 AAGAAGTAAAGAGTGGGTGGGGG + Intergenic
934708757 2:96502203-96502225 AGGAAGGGATGAGTGCATCATGG - Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936827089 2:116594877-116594899 AAGAAGTCAGGAGTGAGGCAAGG - Intergenic
937622170 2:124001480-124001502 AGGAAGTGTTGGGTGGGTAAAGG + Intergenic
938051853 2:128180734-128180756 ATGTAGTCATGAGTGGGTCACGG + Intronic
940581214 2:155583814-155583836 GAGCAGAGATGAGTGAGTCAGGG + Intergenic
940619058 2:156087910-156087932 AAGAAGTGATGGGTGGACAAAGG + Intergenic
941613247 2:167687505-167687527 AAGAAGAGAAGAGAGGGGCAAGG + Intergenic
942511791 2:176710174-176710196 AATAAGTGTTGAGTGATTCAGGG - Intergenic
944859840 2:203804884-203804906 AATCAGTGATGAGTGGGTGGAGG + Intergenic
948782681 2:240332715-240332737 AAGCGGTGAAGAGTGGGGCAGGG + Intergenic
1169281132 20:4267805-4267827 AAGAAGAGAGGACTGGGTGAGGG + Intergenic
1170129524 20:13003664-13003686 AAGGAGTGAAGAGTAGGGCAGGG + Intergenic
1170398567 20:15955247-15955269 ACGAATTAATGAGTGGGTCATGG - Intronic
1171179123 20:23079038-23079060 AAAGAGTGATGAGGGGGCCATGG + Intergenic
1172647686 20:36481496-36481518 AACAAGTGATTAGTGTGTCTGGG - Intronic
1174741255 20:53016259-53016281 AAGAAGTCATGAGTGGGGAGGGG - Intronic
1176662525 21:9651621-9651643 AAGGAGTGGTGACTGGGCCAGGG + Intergenic
1178638700 21:34328447-34328469 AAGAAGTGAAGACTGTTTCAGGG + Intergenic
1183526721 22:38327508-38327530 GAGAAGGGATGGGTGGGGCAAGG - Intronic
1184695177 22:46135005-46135027 AAGAAGGGCTGAGAGGGGCAGGG + Intergenic
949834739 3:8255463-8255485 AAGCATTGATGAATGGTTCAGGG + Intergenic
950137020 3:10588666-10588688 AGGAAGTGCTGAGTGGGTGCTGG - Intronic
950304435 3:11907305-11907327 AAGAAGTGATGAGGGGCCCATGG + Intergenic
951522420 3:23621883-23621905 GAGAAGTGATGAGTAGGGAAGGG - Intergenic
952068932 3:29609355-29609377 AAGAACTGATGAAAGGGTCCTGG + Intronic
952809290 3:37387073-37387095 AAGAACTGAGCAGTGGGCCAAGG - Intronic
953699586 3:45185435-45185457 AGGAAGGGAGGAGTGGGGCATGG + Intergenic
954082922 3:48223081-48223103 AAGAATTGATGAATGAGGCAGGG - Intergenic
954559481 3:51544522-51544544 AAGAAGTGATTAGTTGGTTTGGG + Intronic
954622657 3:52004880-52004902 AAGAACTAATGAGTGGGTATGGG - Intergenic
954994127 3:54866226-54866248 AAGAATGGATGAGTGAGTGAAGG + Intronic
955301590 3:57784807-57784829 AAGAGGTGATTATTAGGTCATGG + Intronic
956610544 3:71117975-71117997 AAGAAGAAGTGGGTGGGTCAGGG + Intronic
957111883 3:75972390-75972412 AAGAAGGGAACAGTGGGGCAGGG + Intronic
958942120 3:100328297-100328319 AAGAAGTCATTGGTTGGTCACGG + Intergenic
959159399 3:102705547-102705569 AAGAATTGAGGAGTGAGTCTAGG + Intergenic
959908578 3:111737448-111737470 AACAAGTTTTGGGTGGGTCAGGG - Intronic
962185302 3:133252664-133252686 AAGAAAAGATGAAGGGGTCAAGG + Intronic
962587611 3:136858546-136858568 AATTAGTGCTGAGTGGATCAGGG - Intergenic
964317112 3:155456652-155456674 GAGAAGGTATGAGTGGTTCAGGG - Intronic
965789852 3:172375598-172375620 AAGAAATTATGAGAGGGGCATGG - Intronic
965808687 3:172569833-172569855 AGCAAGAGGTGAGTGGGTCATGG + Intergenic
969146767 4:5130782-5130804 TGGAAGGGATGAGTGGGGCAGGG - Intronic
972046155 4:34666830-34666852 AAGAAGTGATGGGAGGGTATTGG + Intergenic
975690104 4:76954521-76954543 CAGCAGGCATGAGTGGGTCAGGG - Intronic
975781513 4:77845391-77845413 AAGATGTGAAGTGTGTGTCAAGG + Intergenic
976671873 4:87662848-87662870 AAGAGGTGGTGAGTGAGTCCAGG + Exonic
978038629 4:104029422-104029444 AATAATTGATGAGTTTGTCAAGG + Intergenic
980822814 4:138038785-138038807 AGGAAGTGAGCAGTGGGTGAGGG + Intergenic
983136137 4:164083067-164083089 AAGAAATGAAGAGTGGTACATGG - Intronic
983985267 4:174052233-174052255 AAGGAGTTATGAGTGGGTCATGG - Intergenic
985412870 4:189704904-189704926 AAGGAGTGGTGACTGGGCCAGGG - Intergenic
986065002 5:4226805-4226827 AGGAAGTGATGAGTAGGGAAGGG + Intergenic
986185328 5:5430556-5430578 AAGCAGGGATGAGTGGGGCTGGG - Intronic
990690774 5:58361332-58361354 AAGGAGTGATGCATGGGTCTAGG - Intergenic
991493345 5:67204673-67204695 ATGAAGTGAGGAGTGGCCCATGG - Intergenic
991541321 5:67732479-67732501 ATGAAGTGGTGAGTGAGCCAGGG + Intergenic
991617696 5:68514292-68514314 AAGAACTGATGAGGGTCTCACGG - Intergenic
1001323805 5:170704718-170704740 AAGAGGTGAAGAGTGGGACCTGG - Intronic
1003192825 6:3889291-3889313 AAGAAGAGATGTGTAGGGCAAGG - Intergenic
1004143076 6:13038883-13038905 GAGAAGTGATGACTGGAACATGG - Intronic
1004821783 6:19375203-19375225 AAGCAGAGCTGAGTGGCTCATGG + Intergenic
1005129379 6:22487138-22487160 AAAAAGAGATGAGTGGAACAAGG + Intergenic
1005359398 6:25016681-25016703 AAGAAGTGATGAATCAGTTAAGG - Intronic
1008393535 6:50980601-50980623 AATAGAAGATGAGTGGGTCATGG - Intergenic
1009265160 6:61545148-61545170 AAGAAGTGATAATTGGGGCTGGG + Intergenic
1009912171 6:69943914-69943936 AAGAAGTCATTAGTGGGTTTTGG - Intronic
1010631672 6:78206180-78206202 AAGAAGTTATGGGTGAGTCTTGG - Intergenic
1012230007 6:96750144-96750166 AAGAAGTCAGTAGTGGGTGAAGG + Intergenic
1012802780 6:103854204-103854226 TGGAAGGGATGAGTGGGCCAGGG + Intergenic
1013500001 6:110739544-110739566 ATGAAGTGAAGAGTGGCTGAAGG - Intronic
1016338828 6:143038917-143038939 CAGGAGTGATGAGTTGGCCATGG - Intergenic
1018538139 6:164845913-164845935 AATAAATGATGAGTGTTTCAAGG + Intergenic
1022282084 7:28921275-28921297 AAAATGTGATAAGTGGGTTAGGG - Intergenic
1023839138 7:44086104-44086126 AGGCAGTGAGGAGTGGGTCTGGG + Intergenic
1024035326 7:45503177-45503199 AAGGGGTGCTGGGTGGGTCATGG + Intergenic
1024159949 7:46663652-46663674 AAGTAGGGCTGACTGGGTCAGGG + Intergenic
1024686351 7:51750212-51750234 AAGAAGAGATGAGTGAGCTAGGG - Intergenic
1024889027 7:54180239-54180261 AAGAAGTGACTAGTGGGGCCAGG + Intergenic
1026288014 7:68980692-68980714 AAGGAGTGTTTAGTGGATCATGG - Intergenic
1028002291 7:85514462-85514484 AAAAAGTGCAGAGAGGGTCAAGG - Intergenic
1030713749 7:112785856-112785878 AAGAACTGATCAATGGTTCACGG + Intronic
1031273499 7:119686618-119686640 AAGAAGTGTTGAGCTGATCAGGG + Intergenic
1031386499 7:121158136-121158158 AGGAAGTAATTATTGGGTCATGG + Intronic
1031523707 7:122798252-122798274 AAGTATTGATGTTTGGGTCAAGG - Intronic
1032945186 7:136843437-136843459 AAGAAGTGATGAGAGAGAGAAGG - Intergenic
1034118098 7:148602303-148602325 AATAAGTTAAGGGTGGGTCACGG + Intronic
1038200089 8:25403782-25403804 AAGGAGTGATGCGTGGCTAAAGG - Intronic
1038624803 8:29180967-29180989 AAGAAGTGAAGACTGGGTAATGG - Intronic
1038861857 8:31396500-31396522 AAGAGCTGATGAGTGGGTGTGGG - Intergenic
1040436614 8:47397724-47397746 AAGGAGTGACGACAGGGTCATGG + Intronic
1040932347 8:52748240-52748262 AAAACCTGAAGAGTGGGTCATGG - Intergenic
1041403038 8:57464643-57464665 AAGAAGTAGTGAGGAGGTCAGGG + Intergenic
1041835599 8:62209830-62209852 AAAAAGTAAAGAGTGGGTCTAGG + Intergenic
1042950790 8:74198934-74198956 AGAAAGAGATGACTGGGTCAGGG - Intergenic
1044687626 8:94842770-94842792 AAAAAATGATGAGTGAGCCAAGG - Intronic
1044749374 8:95401381-95401403 CAGAAGTGGTGATGGGGTCATGG + Intergenic
1045406879 8:101875420-101875442 ATGAAGTGATGAAAGGGACAGGG - Intronic
1045912878 8:107430698-107430720 AAGTAGTGGTCAGCGGGTCAGGG + Intronic
1046295744 8:112217624-112217646 AAGCAGTGATGAGAGGGTTACGG + Intergenic
1046585174 8:116141806-116141828 AACAAGTGATAATTGGCTCAGGG + Intergenic
1047812828 8:128429008-128429030 AAGAAGTGCTTAGATGGTCAGGG + Intergenic
1048916374 8:139188060-139188082 AAGAGGTGATGAGTACGTAAGGG + Intergenic
1049268002 8:141679759-141679781 AAGAAGAGTGGAGTAGGTCATGG - Intergenic
1050029644 9:1372219-1372241 AGGAAGGGAGGAGTGAGTCAAGG + Intergenic
1050125446 9:2352595-2352617 AAGAAGGGCTGAGTGGGTAAGGG + Intergenic
1050554333 9:6776247-6776269 AAGATGTGTTGAGCGGGGCATGG - Intronic
1051168214 9:14288754-14288776 AAGTAGAAATGAGAGGGTCATGG - Intronic
1055297550 9:74849954-74849976 AAGAGGTGATCAGTGGGCTAAGG + Intronic
1057811498 9:98260391-98260413 GATAAGTCATGAGTGGGACAAGG + Intergenic
1059164225 9:112063468-112063490 AAGAAGTGATGAGTATATCATGG + Intronic
1059916355 9:119106078-119106100 AAGAATTGGTGAGTGGGTGCAGG + Intergenic
1060350470 9:122854063-122854085 AAGAAGTAATGAGTTGCTCTTGG + Exonic
1060876577 9:127088187-127088209 ATGAAGGGATAAGTGGGTGATGG + Exonic
1188883039 X:35513601-35513623 AAGAAGAGATGTGTGGGGTAAGG - Intergenic
1190123072 X:47679505-47679527 AAGAAGTGAAGAATGAGACAAGG + Intergenic
1191224657 X:58030781-58030803 CAGAGGTGAAGGGTGGGTCATGG + Intergenic
1191641151 X:63430742-63430764 AAGAAGAGATCAATGGCTCATGG + Intergenic
1192590472 X:72355425-72355447 AAGAAGTGCTGAGGGGGAAAGGG - Intronic
1194765948 X:97845486-97845508 AAGAGGTGGTGAGGCGGTCAGGG - Intergenic
1195211699 X:102656429-102656451 AAGAAGTCATTATTGGGTCCTGG + Exonic
1195784580 X:108505228-108505250 CAGAAGTGAGGAGTCGGTGAGGG + Intronic
1196969470 X:121093060-121093082 AAGAAGTGAGGAGTGTGTGTTGG + Intergenic
1197313974 X:124941089-124941111 GAGAAGTGATGGGATGGTCAAGG - Intronic
1197446819 X:126560929-126560951 AAGAAGTGAGGTTTGGGTCAAGG - Intergenic
1197507298 X:127321797-127321819 AAGAGGTGATGAATGGATAAGGG - Intergenic
1197728773 X:129793521-129793543 AAGCAGTGAGGAGAGGGGCAGGG + Intronic
1199400867 X:147396661-147396683 ATGAAGTTTGGAGTGGGTCATGG - Intergenic
1200829957 Y:7679995-7680017 AAGAAGTGGGCAGGGGGTCAGGG - Intergenic
1201395643 Y:13544761-13544783 AGGCACTGATCAGTGGGTCAGGG + Intergenic
1202068162 Y:20962234-20962256 AAGGGGTGGTGAGTGGGTCATGG - Intergenic