ID: 1113183933

View in Genome Browser
Species Human (GRCh38)
Location 13:107664471-107664493
Sequence TTGCATTAAATAGGAAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113183933_1113183938 13 Left 1113183933 13:107664471-107664493 CCATTGTTTCCTATTTAATGCAA 0: 1
1: 0
2: 3
3: 31
4: 392
Right 1113183938 13:107664507-107664529 ACCTATGGTGACGCCCTCTAAGG 0: 1
1: 0
2: 0
3: 1
4: 20
1113183933_1113183936 -2 Left 1113183933 13:107664471-107664493 CCATTGTTTCCTATTTAATGCAA 0: 1
1: 0
2: 3
3: 31
4: 392
Right 1113183936 13:107664492-107664514 AAAGGAAAAGCCAACACCTATGG 0: 1
1: 0
2: 0
3: 19
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113183933 Original CRISPR TTGCATTAAATAGGAAACAA TGG (reversed) Intronic
903235157 1:21945492-21945514 TTCCAGTAAATAGTAAGCAAAGG - Intergenic
904136967 1:28320409-28320431 TTTCATTTAAAAGGAAAAAAAGG + Intergenic
904551129 1:31319273-31319295 ATACATTAAAAAGAAAACAAAGG - Intronic
904738926 1:32656824-32656846 TTTCATTAAAAAGGAAAGAAGGG - Intronic
908009144 1:59757918-59757940 TTCCATTTAATAGGAAGCAATGG + Exonic
908518437 1:64917104-64917126 TTTCATAACATTGGAAACAAGGG + Intronic
908551653 1:65214410-65214432 TTTCATCAGATATGAAACAAGGG - Intronic
909368075 1:74851818-74851840 TTCCAATAAATAGAAAAAAATGG - Intergenic
910298049 1:85672231-85672253 GAGCAATAAATAGGAATCAAAGG - Intronic
910360893 1:86412853-86412875 TTGCATTGAATAACAAAGAAGGG - Intergenic
910440147 1:87243455-87243477 TTGCATTAAATAAAAGACAAAGG - Intergenic
910921529 1:92353113-92353135 ATCCATTAAATAGCAAAAAATGG - Intronic
911157859 1:94654400-94654422 TTGCATTGAATAGGAATAAAAGG + Intergenic
911234800 1:95400756-95400778 TTGTATAAAATAAGAAACCATGG + Intergenic
911479712 1:98422724-98422746 TTGAATTAAAGATGCAACAAAGG + Intergenic
912115939 1:106408041-106408063 ATGCTTTAAATATGAAAGAAAGG - Intergenic
912190428 1:107332610-107332632 TTGCACTAAGTATCAAACAATGG - Intronic
912918016 1:113837046-113837068 TTCCATGAAACAGGCAACAATGG - Intronic
913300129 1:117361403-117361425 TTGCATAATATTGGAAACAAAGG - Intergenic
913398542 1:118400523-118400545 ATGCCATAAATAGAAAACAAAGG + Intergenic
914227535 1:145733541-145733563 TTGAATTAACTAGGAACCATAGG - Intronic
915781526 1:158556118-158556140 GTTCAGTAAATAGGAAACATAGG + Intergenic
917561283 1:176159264-176159286 ATTCATCAAATAGAAAACAAGGG + Intronic
918032570 1:180829879-180829901 ATGCATTAAATAAGGAAAAAAGG - Intronic
918810867 1:189117947-189117969 TCAAATGAAATAGGAAACAAGGG + Intergenic
918894420 1:190321395-190321417 ATGCATAAAAGAGGAAGCAAAGG + Intronic
919531991 1:198733492-198733514 TTGGATTAAATTTGAAACATGGG - Intronic
923439270 1:234000373-234000395 TTGCGTAAAATTGGGAACAAAGG - Intronic
923895594 1:238266761-238266783 TAGCATTAAATAGAAAACACAGG + Intergenic
1063489613 10:6451533-6451555 TTCCACTAAATAGAAAAAAAGGG + Intronic
1063852826 10:10212367-10212389 TAGAAATACATAGGAAACAAAGG + Intergenic
1064039314 10:11944972-11944994 TTGCAGTAGGTGGGAAACAAAGG - Intronic
1064250200 10:13700859-13700881 TTGCATTAAAAAAAAAAAAATGG + Intronic
1064651473 10:17514257-17514279 ATGCATTAAACAGGATACATAGG - Intergenic
1064897829 10:20259203-20259225 TTTCATTAAAAAGAAAAAAAAGG - Intronic
1065330946 10:24598628-24598650 TTGGAATGAATAGGAAAAAAAGG - Intronic
1066766760 10:38809895-38809917 TTGCATCGAATAGAAAGCAATGG - Intergenic
1066769021 10:38828778-38828800 TGGCATTGAATAGAAAGCAATGG + Intergenic
1068067153 10:52146028-52146050 TTGCCTTTAATAGGCAAGAAGGG + Intronic
1068167904 10:53355220-53355242 TTGCATTAAAAAGTGAGCAAAGG + Intergenic
1069401826 10:68056099-68056121 TTGCTTTGAAGAGGAAAGAAGGG + Intronic
1070717940 10:78736069-78736091 TTGTATTAGCAAGGAAACAAAGG + Intergenic
1071098063 10:82002343-82002365 TTGAATAAAACAGGAATCAAAGG - Intronic
1071125171 10:82326271-82326293 CTGCATTATACAGAAAACAAAGG - Intronic
1072468056 10:95685836-95685858 TTCTATTAAATATAAAACAAGGG + Intronic
1074195216 10:111178195-111178217 TTGAATAAATTAGGAAATAAAGG - Intergenic
1074701152 10:116093673-116093695 TTGTAAAAAATAAGAAACAAAGG - Intronic
1075171884 10:120123006-120123028 TGGCATTAAAATGGAAAGAAAGG + Intergenic
1076784478 10:132742995-132743017 TAGCATGAAATCAGAAACAATGG - Intronic
1078270028 11:9786753-9786775 GTGGATTAAATAGGATACGAAGG + Intronic
1078411569 11:11124599-11124621 TTCCATTAAAAAGTAGACAAAGG - Intergenic
1079173300 11:18116495-18116517 TTGCCTTAGATAAGAACCAAAGG - Intronic
1079442106 11:20525350-20525372 TTGCATGAAAAAGGCAACATTGG - Intergenic
1079823254 11:25159114-25159136 ATGAACTAAATAAGAAACAAGGG - Intergenic
1079936031 11:26617363-26617385 TTGCATTTTACAGAAAACAAAGG + Intronic
1080389439 11:31830933-31830955 TTGCTTTCAATAGGTAAGAAGGG - Intronic
1080733917 11:34990901-34990923 TTGTATTACATAGGCAACATAGG - Intronic
1080769494 11:35327136-35327158 CTGGATTAAAAAGGAAAAAAAGG - Intronic
1081158900 11:39729277-39729299 ATTTATTAAATAGGAAAAAAAGG - Intergenic
1081542676 11:44047666-44047688 TTTGGTTAAATAGGAAAAAAGGG - Intergenic
1082076030 11:47976913-47976935 TTAAATTAAATAGCAAACTAAGG - Intergenic
1083150480 11:60788895-60788917 TTGCATAGAAGAGGAAACCAAGG - Intronic
1083918353 11:65765166-65765188 TTGTATGAGTTAGGAAACAATGG - Intergenic
1085589478 11:77745054-77745076 TTGGATTATATAGAAAAAAATGG - Intronic
1085948308 11:81298902-81298924 TTTCATTAAATAGCAAAATATGG - Intergenic
1086296529 11:85373710-85373732 TTGCATGAAAAGGGAAAAAAGGG - Intronic
1086316909 11:85604724-85604746 TTGCATGAAATATGCAACCAAGG + Intronic
1086602424 11:88650607-88650629 TTGGATTACATAAGAAACTAGGG + Intronic
1086726701 11:90195009-90195031 GTGCAGTAACTAGGAAAAAATGG + Intergenic
1086980483 11:93191938-93191960 TTCAATTAAATAGGTTACAATGG + Intronic
1087560114 11:99779052-99779074 TTGTATTAATTAGAAAATAATGG - Intronic
1089423929 11:118353985-118354007 TTGCATTAAAAAGGATATAATGG - Exonic
1089874996 11:121712572-121712594 AAGCATTTAAGAGGAAACAAAGG + Intergenic
1091877296 12:3946347-3946369 TTGATTGAAATAGGAAACACTGG - Intergenic
1092838533 12:12515720-12515742 TTGAAAAAAAAAGGAAACAATGG + Intronic
1093073681 12:14734780-14734802 TTGCTTAAAATAGGAAGCCATGG - Intergenic
1093804394 12:23414349-23414371 TTGAACTAAATAGGAAAAACCGG + Intergenic
1094355373 12:29572393-29572415 TTGCTTTCTATAGAAAACAATGG + Intronic
1094873221 12:34611041-34611063 TTCCAATCAATAGGAAAAAAGGG - Intergenic
1095461611 12:42450109-42450131 TTTCATTAAGTAGGAGAGAAAGG - Intronic
1095772714 12:45979392-45979414 ATGGATTTAATAGGAAAAAAGGG + Intronic
1095935109 12:47671054-47671076 TTTTATTAAATTGGAAAAAAGGG - Intronic
1096018391 12:48299874-48299896 CTGTATTAATTAGGAAATAATGG - Intergenic
1096615191 12:52828569-52828591 TGGCATTTCATAGGAAAGAAAGG + Intronic
1097862160 12:64528621-64528643 ATGTATTAAATAGGCTACAAAGG + Intergenic
1099126534 12:78766164-78766186 GTGCATAAAATAGGAATAAATGG - Intergenic
1099812718 12:87605363-87605385 TTGGATTCAATAGGAATCATGGG - Intergenic
1100177021 12:92042518-92042540 TTGCATTAACTAGCTAACACAGG + Intronic
1100506845 12:95229598-95229620 TTCCATTAATTAGGAAATACAGG + Intronic
1102420325 12:112798412-112798434 GTGCATTAAAAAGGAAGAAAAGG - Intronic
1104402575 12:128488784-128488806 TTGCAATAACTAGGATGCAAAGG + Intronic
1104663052 12:130626230-130626252 ATGCATAAAATAGGAATCAGAGG + Intronic
1105579362 13:21679606-21679628 TTACAATAAAAAGGAAAAAATGG + Intronic
1105702741 13:22945216-22945238 TTGAGTTAAAAAAGAAACAAAGG - Intergenic
1105804242 13:23940995-23941017 TTACACTAATTAGGAAAAAAAGG + Intergenic
1105915582 13:24912704-24912726 TTGCATTAAAAAGGGACCACAGG - Exonic
1106862608 13:33926865-33926887 CTGTATTAATTAGGAAATAATGG + Intronic
1107640904 13:42442233-42442255 TTTCATTAACAAGGAAAGAAGGG - Intergenic
1108927168 13:55766888-55766910 ATGCCTTAAATATGAAACTATGG - Intergenic
1109164262 13:59013951-59013973 TTGCAATACATGGGAAAAAAAGG + Intergenic
1109516909 13:63455686-63455708 TAGCATTTAATAGGACAAAATGG + Intergenic
1109713499 13:66189286-66189308 TTGCATTGATTGGGAAATAATGG - Intergenic
1110235095 13:73209516-73209538 GTGCACTAAAAAGGAAACACAGG - Intergenic
1110958519 13:81589351-81589373 TTGGATAAAATAGGATATAAAGG - Intergenic
1111226571 13:85280897-85280919 TTGCAATAAATTGGAGAAAAGGG - Intergenic
1111414461 13:87921105-87921127 CTGCAATGAATAGGAGACAATGG - Intergenic
1111868716 13:93802974-93802996 TTTCATTAACTGTGAAACAAAGG + Intronic
1112267982 13:97942820-97942842 ATGCATTGCATAGGTAACAATGG - Intergenic
1112798167 13:103080364-103080386 TTTTACTAAAGAGGAAACAAAGG - Intergenic
1113183933 13:107664471-107664493 TTGCATTAAATAGGAAACAATGG - Intronic
1113663141 13:112120606-112120628 TTGCATTATCTAGGAAGAAAAGG + Intergenic
1114718396 14:24853109-24853131 TTGCATGGTATAAGAAACAATGG + Intronic
1115031281 14:28797535-28797557 ATACATTAAATAGTAAAAAATGG + Intronic
1115488230 14:33933534-33933556 ATGCATCAAGTTGGAAACAATGG + Intronic
1116419726 14:44719108-44719130 GTGCAGTAAGCAGGAAACAATGG + Intergenic
1116609691 14:47052215-47052237 TTGCATTAGAAAAGAAAGAAGGG + Intronic
1116707466 14:48320239-48320261 TACCATTATATAAGAAACAAAGG - Intergenic
1118146344 14:63141520-63141542 TTGCAATCAATAGGAAAAGAGGG - Intergenic
1118938191 14:70307596-70307618 TTCCAATCAATAGAAAACAAGGG - Intergenic
1119040990 14:71274446-71274468 TAGCATTAGATAAGAAATAAAGG + Intergenic
1120027060 14:79598451-79598473 TTGCATAAAATACGAGAAAATGG - Intronic
1120141693 14:80936649-80936671 TTGCATTATATGGGAACCAAAGG + Intronic
1120202901 14:81556984-81557006 TGGCATAAAATATGCAACAAAGG - Intergenic
1121088164 14:91162593-91162615 TTTAATTAAAAAGGAAACAAAGG + Intronic
1121293912 14:92800832-92800854 TTGCATTTAATTAGAAAGAATGG + Intronic
1122858561 14:104571902-104571924 TGGCATTAAATCGCAAGCAATGG + Intronic
1125177392 15:36840150-36840172 TTGCTTTAGAAAGGAAGCAAAGG - Intergenic
1126456730 15:48870556-48870578 ATCCATTAATTAGAAAACAAGGG + Intronic
1127371987 15:58349985-58350007 ATTCATTAAATCGGAAATAATGG - Intronic
1127539573 15:59923320-59923342 CTTCATTAAATTGGAAACAAAGG - Intergenic
1127713912 15:61628679-61628701 TTGTAATAAATAGGAAACTCAGG + Intergenic
1127736049 15:61840214-61840236 TTGCATGAAACTGAAAACAAGGG - Intergenic
1127777054 15:62272328-62272350 TTGCATTCAACAGGAAATTAAGG + Intergenic
1127937672 15:63658279-63658301 TTGCTTGAAATGGGAAACTAAGG - Intronic
1130126736 15:81100429-81100451 TTGCTTTAAATAATGAACAATGG + Intronic
1130700346 15:86173270-86173292 TTCCATTAAAAAGTAGACAAAGG - Intronic
1135245113 16:20849376-20849398 CTGCAATAAATAAGAAACAAAGG - Intronic
1135495109 16:22944574-22944596 TGGCATTTAATAGAAAATAAAGG - Intergenic
1136094352 16:27944318-27944340 TTGCAATAAAAAGGAAGGAATGG + Intronic
1138915620 16:61460585-61460607 CTGCTTTAAAAAGAAAACAATGG + Intergenic
1139836547 16:69843426-69843448 TTGCAATAAACAATAAACAAAGG - Intronic
1140162750 16:72515729-72515751 TGGAATTAAATTAGAAACAAGGG - Intergenic
1143760580 17:9100702-9100724 TTGCATTAAAAGGTAGACAAAGG - Intronic
1144056490 17:11546616-11546638 AGGCATTAAATAGGACAGAAAGG + Intronic
1144287686 17:13794129-13794151 ATGCATTTAATAGGAAATATAGG - Intergenic
1145722086 17:27082921-27082943 TGGCATGAAGTAGGACACAAAGG + Intergenic
1146859105 17:36281008-36281030 TTGCACTAAAAAGGAATAAAGGG - Intronic
1147089427 17:38085095-38085117 TTGCACTAAAAAGGAATAAAGGG - Intergenic
1147107784 17:38235424-38235446 TTGCACTAAAAAGGAATAAAGGG + Intergenic
1148318620 17:46728256-46728278 TTTCAATAAAACGGAAACAATGG - Intronic
1148421607 17:47552419-47552441 TTGCACTAAAAAGGAATAAAGGG - Intronic
1150194387 17:63280117-63280139 TTTCATTAAATGTGAAACAAAGG - Intronic
1151050091 17:70968167-70968189 TTCTATTAAATGGGAAAAAATGG + Intergenic
1151071774 17:71221964-71221986 TTGGATTTTATAGGAAACAGGGG - Intergenic
1151363652 17:73603708-73603730 TTGCTTTAAAGACGAAACCAAGG + Intronic
1151524186 17:74652661-74652683 TTTCAGTAAAAAGGAATCAAAGG - Intergenic
1153042280 18:824606-824628 ATTTATTAAATAGGAAATAATGG - Intergenic
1153384785 18:4479725-4479747 TTGAAATAAATAGGAAACTGGGG + Intergenic
1153453031 18:5250699-5250721 TTGCATATAACAGGAAAAAAGGG + Intergenic
1155180287 18:23339569-23339591 TTGCTTTACAGATGAAACAATGG + Intronic
1155628862 18:27867948-27867970 ATGCATTAATTAGAAAAAAATGG + Intergenic
1156768697 18:40692335-40692357 TTCCATAGAATAGGAAAAAATGG - Intergenic
1157084258 18:44562582-44562604 ATGTATTGAATAGGAAATAATGG - Intergenic
1157968347 18:52236203-52236225 ATGGATTAAAAAGGAAAAAAAGG + Intergenic
1159436711 18:68427405-68427427 TTGCATTATATAGAAAACTGAGG + Intergenic
1159509469 18:69377593-69377615 TTGGAATAAATCGGAAAGAAAGG + Intergenic
1159736188 18:72100749-72100771 TTGTATGAAAGAGGAGACAATGG + Intergenic
1159745634 18:72231174-72231196 TTTTATTTAATAGAAAACAAAGG + Intergenic
1164149251 19:22534765-22534787 TTGCATTAGATAGGACACAATGG - Intergenic
1164155506 19:22594374-22594396 TTGGGTTAGATAGGACACAATGG + Intergenic
1164245323 19:23423131-23423153 TTGTTTTATAAAGGAAACAAAGG + Intergenic
1164308737 19:24028410-24028432 TTGTTTTATAAAGGAAACAAAGG - Intergenic
1167779904 19:51592471-51592493 TTTCATTAAATCTGAAATAAAGG + Exonic
1167952636 19:53039575-53039597 TTGCTTTAAATAATAAGCAATGG + Intergenic
1168351131 19:55676318-55676340 TTACATTAAAAAGAATACAAAGG - Intronic
925031250 2:651343-651365 TTGAACTAAATAACAAACAAGGG + Intergenic
925042584 2:744397-744419 CTGAAGTAAATAGAAAACAAAGG - Intergenic
925531749 2:4870835-4870857 TGGCGTTAACTAGAAAACAAAGG - Intergenic
926636561 2:15186235-15186257 TGGCATCAAATAGAGAACAAAGG + Intronic
927126667 2:20018467-20018489 TTGAATAAAATAGGAATCATTGG - Intergenic
928039424 2:27859715-27859737 TAGCTTTAGATAGGAAAGAAAGG + Intronic
928847467 2:35694691-35694713 TTGCATTGAATGGGAGAAAACGG - Intergenic
929865451 2:45713600-45713622 TTTCTTTAAATAGGAAACCATGG + Intronic
930005031 2:46889972-46889994 ATGCATAAAATAAAAAACAAAGG - Intergenic
930254208 2:49070442-49070464 TTGTGTTAAATAGGAACAAAAGG - Intronic
932147088 2:69330572-69330594 TTGCATTAAAAAAAAAAAAAAGG + Intronic
933028429 2:77293165-77293187 TGTCATTAAATATGAAACTAAGG + Intronic
933518288 2:83333899-83333921 TTGTATTAATTTGGATACAATGG - Intergenic
934635157 2:95979762-95979784 TTGCTTTAAAGAGAAAAAAAAGG + Intronic
934798473 2:97125476-97125498 TTGCTTTAAAGAGAAAAAAAAGG - Intronic
934834956 2:97578020-97578042 TTGCTTTAAAGAGAAAAAAAAGG + Intronic
934918300 2:98319393-98319415 TTGCACTAAATAGCAGACAAAGG + Intergenic
935448580 2:103183924-103183946 TTTCAGGAAATAGGAAAGAAGGG + Intergenic
935505644 2:103898898-103898920 TTGGAATAAAAAGGAAACATAGG + Intergenic
935922037 2:108026242-108026264 TTGCAGTAAAAAGGAAACACAGG - Intergenic
939943725 2:148383562-148383584 TTCCAATAAATAGAAAAAAAGGG + Intronic
940820425 2:158348703-158348725 TAGCAGTATAGAGGAAACAAGGG + Intronic
941427356 2:165365311-165365333 TTTAAATAAATAGGAAAAAATGG - Intronic
941946912 2:171109340-171109362 TTGTGTTAAAAAGGAAACAAAGG + Intronic
942737155 2:179127495-179127517 TTACATTAAGTAGGTAACAGAGG + Intronic
942750387 2:179279895-179279917 TTGCATAAAAAAACAAACAAAGG - Intergenic
942994175 2:182241102-182241124 TGCCATTAAAGAGGAAACTAAGG + Intronic
943501561 2:188695900-188695922 TTTCATTAAGTAGGAATCACAGG + Intergenic
1169514936 20:6305628-6305650 TTGCAGTGACTAGGAAGCAAAGG + Intergenic
1170394011 20:15906323-15906345 TTGTTTAAAATAAGAAACAAAGG - Intronic
1170539960 20:17377622-17377644 TTCCTTTCAATAAGAAACAAAGG - Intronic
1171507862 20:25653512-25653534 TTGCCTTAGATAGATAACAAGGG - Intergenic
1174103798 20:48147773-48147795 TTGCATTAAAATGGGCACAATGG + Intergenic
1174814950 20:53678997-53679019 TAGCATTAAACAGAAAGCAAAGG + Intergenic
1174843766 20:53923396-53923418 TTGCTTGAAATAGGATACAAAGG + Intergenic
1178659972 21:34499147-34499169 TTGCATTATATAGGTCACCAGGG + Intergenic
1182514690 22:30848414-30848436 TTGATTTAAAAAGGAAAAAAAGG - Intronic
1182961559 22:34480169-34480191 TGGCTTCAAATAGGCAACAAAGG - Intergenic
1183497792 22:38159217-38159239 ATACATTAAAAAGGAAATAAGGG + Intronic
1183779730 22:39991379-39991401 TTGGATTAATTATTAAACAAGGG + Intergenic
1184013050 22:41763876-41763898 TTAGATTACATAGGAAACATAGG - Intronic
1184377203 22:44121300-44121322 ATGTATTAAAAAGGAAAGAAGGG - Intronic
1184964267 22:47956694-47956716 TAGCATTTGAAAGGAAACAAAGG - Intergenic
949840825 3:8317986-8318008 TGGCATTACAGAGGAATCAAGGG + Intergenic
951422714 3:22506740-22506762 TTACATTAAATAGTTAGCAAAGG - Intergenic
951675046 3:25229655-25229677 TTGCATTAAAGAAAAAAAAAAGG - Intronic
951779031 3:26341822-26341844 AGGCCTTAAATAGGAAACATTGG - Intergenic
951814514 3:26738957-26738979 TTGCATTATATTGGAGAGAAGGG - Intergenic
954774511 3:53004570-53004592 TTGCTTTAAAAAAGAAAGAATGG - Intronic
955628595 3:60947859-60947881 TTGCATTTGATTGGAAATAAAGG + Intronic
955898720 3:63728493-63728515 TCGCTTTAAATAGGAAAAATTGG - Intergenic
955963851 3:64367883-64367905 TTGTTTCAAATAGTAAACAAGGG + Intronic
956138099 3:66118702-66118724 TTCAATTAAATAGGAAAAATAGG - Intergenic
956250933 3:67232958-67232980 GTGTATTAAATAAGAAAGAATGG - Intergenic
956415459 3:69023474-69023496 TTGAACTAAATAGCAAAAAAAGG + Intronic
956462008 3:69481973-69481995 TTGCATTAAAAAAGAAAAAAAGG - Intronic
956592977 3:70935002-70935024 TTGCTGAAAATGGGAAACAAGGG - Intergenic
957782028 3:84832367-84832389 TTGCAGCAAATAGAAAAAAAAGG + Intergenic
958271079 3:91500516-91500538 TTGAAATAAATAGGAAAATATGG - Intergenic
958709791 3:97704051-97704073 ATGAATTAAATAGGAAAAAGTGG + Intronic
958931866 3:100215992-100216014 GTGGATTAAAAAGGACACAAAGG - Intergenic
959238740 3:103760318-103760340 TTGTACTTAATGGGAAACAAGGG + Intergenic
960354180 3:116630639-116630661 TTGCATTTAATATGGAATAAAGG + Intronic
960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG + Intronic
961675900 3:128566420-128566442 TTGCAGGGAATGGGAAACAAAGG + Intergenic
962330056 3:134470462-134470484 TTGTATTACATTGAAAACAATGG + Intergenic
963122062 3:141784548-141784570 CTGCAATGAATAGGAAACTAAGG - Intronic
963563483 3:146897783-146897805 AAGCATTAAATAGGAAAAAATGG + Intergenic
964574745 3:158153091-158153113 TTGCTTTAAAAAGGACAGAAAGG - Intronic
965318903 3:167227044-167227066 TTGCATTAGTTAGGACACACTGG - Intergenic
965411155 3:168333305-168333327 GTGCACAAAATAGCAAACAAAGG + Intergenic
965501671 3:169463785-169463807 TACCATTTAAGAGGAAACAAAGG - Intronic
966435546 3:179879831-179879853 TGGCATTAAACAGAGAACAAAGG - Intronic
967232805 3:187356577-187356599 TTGCTCTAAAGAAGAAACAATGG + Intergenic
968743941 4:2348990-2349012 ATGCAATAAACAGAAAACAAGGG - Intronic
969120720 4:4908934-4908956 TTACCCTAAATAGGAAACCAGGG - Intergenic
969288140 4:6221165-6221187 TTGAGTAAAAAAGGAAACAAGGG + Intergenic
970104440 4:12564849-12564871 CTTCATGAAATAGGAAATAATGG + Intergenic
971083150 4:23239076-23239098 TTAAATTAACTTGGAAACAATGG + Intergenic
971696133 4:29905994-29906016 TGGAATTAAATATGAAAAAAGGG - Intergenic
972103644 4:35454358-35454380 ATGTATTAAAAAGGAAAGAAAGG + Intergenic
972338152 4:38127189-38127211 TTACAGAAAATAGGAGACAATGG - Intronic
972886100 4:43490637-43490659 TTTCATTAAATATTAAAAAATGG + Intergenic
972900516 4:43676354-43676376 ATGCATTAAAAAGGAAAGAGAGG - Intergenic
973967378 4:56177552-56177574 TTGCAACAAATTGGAAAGAAGGG - Intronic
974337855 4:60574457-60574479 TTTCAATAATGAGGAAACAAAGG - Intergenic
976072034 4:81252643-81252665 CTGCATTAAAAGGGAAACCAAGG - Intergenic
976785127 4:88811011-88811033 GTGCATTATATAGCAAGCAAGGG - Intronic
976928825 4:90536760-90536782 TTCCATCAAAAAAGAAACAATGG - Intronic
977087461 4:92620676-92620698 TTGCATATAATAGGAAACAAAGG + Intronic
977713434 4:100153747-100153769 TAGCCTTAAAAAGGAAACTATGG + Intergenic
977718162 4:100207578-100207600 TTGGGTTAGATAGGACACAATGG + Intergenic
979036817 4:115731099-115731121 TTGCATGAAAGAGGAGAGAATGG + Intergenic
979723339 4:123930026-123930048 TTGCATAAAATGGAAAACAAAGG - Intergenic
980623511 4:135342231-135342253 TTGCTTTTAATAGAAACCAAAGG + Intergenic
980680186 4:136150720-136150742 TTGCATCAAATGGCAAAAAAAGG - Intergenic
981140557 4:141263308-141263330 TTCCAGGAAATAGAAAACAAGGG + Intergenic
981398453 4:144282531-144282553 TTGCATTAAACATTAAACAGAGG - Intergenic
981583369 4:146273074-146273096 TTGAAATTAATAGGAAACTATGG + Intronic
981609417 4:146577632-146577654 TTGCATTTGATAGGGAATAAAGG - Intergenic
982537226 4:156621851-156621873 ATGCATTAAAAAGGAAAGAGTGG + Intergenic
983338293 4:166423727-166423749 TTGCATGAAACAAGAAACATTGG + Intergenic
984055624 4:174926007-174926029 TTACACAAAATAGGAAATAAAGG - Intronic
984117537 4:175700879-175700901 TTGCATAATATAGAGAACAAAGG - Intronic
984365721 4:178797761-178797783 ATCCATTAAATCTGAAACAAAGG - Intergenic
984438201 4:179730270-179730292 TTCTATTAAATAGTAAAAAATGG - Intergenic
985347385 4:189020408-189020430 TTAGAATAAATAGGAAACAGGGG + Intergenic
986380714 5:7182798-7182820 TTGCATGACAGAGGACACAAGGG + Intergenic
986995103 5:13597824-13597846 TTGCATTAAAAAGCAAAAGATGG - Intergenic
988007258 5:25432088-25432110 TAGCATTAAATATGAATGAATGG - Intergenic
988450088 5:31333218-31333240 TAGCATTAAATTGGAAATAGTGG - Intergenic
989814816 5:45722966-45722988 TAGCATTAAGTAGAAAAGAAGGG + Intergenic
990200595 5:53368286-53368308 TTTAACTAAAAAGGAAACAATGG - Intergenic
990356343 5:54970129-54970151 ATGCATTATATAAGAAAGAAAGG + Intergenic
991733356 5:69609993-69610015 TTTTTTTAAATAGGAGACAAGGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
992902067 5:81307013-81307035 TTTTATTAAGTAGGAAAAAAAGG + Intronic
993222137 5:85112249-85112271 TTACATTAAATATGTAAGAATGG + Intergenic
994076269 5:95653420-95653442 TTGAATTTGATAGGAAATAAAGG + Intronic
994317838 5:98354417-98354439 TGGCATAAAATCAGAAACAATGG + Intergenic
994362651 5:98871349-98871371 TTGCCTAAAATGGGAAACACTGG - Intronic
994582913 5:101670411-101670433 GTGCATTAACTAGGGAATAAGGG - Intergenic
995015127 5:107301420-107301442 TGCCAGTAAATAGGAAAGAATGG - Intergenic
995074948 5:107971645-107971667 TTTTATTAAAGAGCAAACAAAGG + Intronic
995278014 5:110299856-110299878 TTGCATTCAATAGTAATCAAAGG - Intronic
995312336 5:110728059-110728081 TTGAATTAAAAAGGAATAAAAGG + Intronic
996572571 5:124947945-124947967 TTGCCTTAATTAGGACACGAGGG + Intergenic
998051938 5:139043190-139043212 TTTCATGAAAGAGGAAGCAATGG + Intronic
998307052 5:141088943-141088965 CTGCATTAAATATAACACAAAGG - Intergenic
999527949 5:152428784-152428806 ATTTATTTAATAGGAAACAAGGG - Intronic
999807316 5:155094516-155094538 TTAGATTGAATAGGAAAAAAAGG + Intergenic
1000195388 5:158952179-158952201 TTACAGTAAATAGGAAAGAAAGG + Intronic
1000715117 5:164632988-164633010 TTGCATTAAGTGGTAAAAAATGG + Intergenic
1002386726 5:178873086-178873108 TTTTATTAAATAAGAAACACAGG - Intronic
1003553160 6:7116888-7116910 TTACATTAAATAGGAGAGATGGG + Intronic
1003970704 6:11296578-11296600 TTGCATTTAGTGGGAAAGAATGG + Intronic
1003987287 6:11449583-11449605 TTGAATTAGAAAGGAGACAAAGG - Intergenic
1004108963 6:12695753-12695775 TTTCATGAAATAGGAAAAAGAGG + Intergenic
1004726341 6:18314685-18314707 TTGGATTAACTAGGGAGCAATGG + Intergenic
1005230134 6:23690496-23690518 TTGCATTAAGGAAGAAAGAACGG - Intergenic
1006197075 6:32250983-32251005 TTGCATTTAATGGAAAATAAAGG + Intergenic
1008454086 6:51688709-51688731 ATGCATAAAATAGAAAACACTGG - Intronic
1008558472 6:52699016-52699038 TTTCTTTAAATATGCAACAAAGG - Intergenic
1008935104 6:56983040-56983062 TTGTATTAAATAGTAAGAAAAGG - Intronic
1008984061 6:57520793-57520815 TTGGAATAAATAGGAAAATATGG + Intronic
1009172119 6:60413701-60413723 TTGGAATAAATAGGAAAATATGG + Intergenic
1009733416 6:67640596-67640618 TTAACTAAAATAGGAAACAAAGG + Intergenic
1010048784 6:71479135-71479157 TTGCATTAAGAAACAAACAAGGG + Intergenic
1010154336 6:72775345-72775367 TTACATTAAATAGAAATAAAAGG - Intronic
1011564633 6:88662180-88662202 TCTCATGAAATAGGAGACAATGG - Intronic
1011865601 6:91822443-91822465 TTGAATTAAAAAGGAAATTAAGG + Intergenic
1011892237 6:92179071-92179093 TGGAATAAAATAGGAAACATAGG + Intergenic
1012262348 6:97102305-97102327 ATGCAGTAGCTAGGAAACAATGG + Intronic
1012646321 6:101686874-101686896 TTGCATAAACTATGAAAGAAGGG + Intronic
1012712239 6:102621591-102621613 TTACATTTAAAAGAAAACAAAGG - Intergenic
1013492953 6:110667809-110667831 TTTCATTAAATAGGACCAAAAGG + Intronic
1013877519 6:114851161-114851183 CTGCATTAAATGTGAATCAAAGG + Intergenic
1014107170 6:117579772-117579794 TTGAGTTGAATAGGAAACAAAGG - Intronic
1014268308 6:119307225-119307247 TTGCATTAAATAGGATTAAATGG - Intronic
1014415831 6:121183241-121183263 TTGTATGAAATAGGGAATAAAGG - Intronic
1014880703 6:126720881-126720903 TCTCATTAAATAGGAAGCAAAGG - Intergenic
1015017905 6:128436656-128436678 TCCCATTTTATAGGAAACAAAGG + Intronic
1015956225 6:138601004-138601026 TTAAATTCAATAGAAAACAAAGG + Intronic
1016169189 6:140987912-140987934 TTGCATAAACAAGGAAATAAGGG + Intergenic
1016531667 6:145065205-145065227 CTGCATCTAATAGGAAATAAAGG + Intergenic
1016639058 6:146327822-146327844 TTGCATCAAAGAAGAAACTAGGG - Intronic
1018311179 6:162510578-162510600 TTGCATTGAAAAGGGAACAGAGG - Intronic
1020583774 7:10038690-10038712 TTTGAAAAAATAGGAAACAAGGG - Intergenic
1020700593 7:11477562-11477584 GACCATTAAATAGGAAACCATGG - Intronic
1021975786 7:26009939-26009961 TTGGAAAAAATAGAAAACAAAGG + Intergenic
1022018758 7:26377664-26377686 TTGCCTTAAAAAAAAAACAAAGG - Intergenic
1022137312 7:27460951-27460973 TTACATTAAAAAGGAAATAGTGG - Intergenic
1023118665 7:36887329-36887351 TGGCACTAAATAGCAAAGAATGG + Intronic
1023239693 7:38130353-38130375 TGCAATTGAATAGGAAACAATGG + Intergenic
1023804749 7:43864702-43864724 TTAAATAAAATGGGAAACAAAGG + Intergenic
1024528327 7:50369068-50369090 TTGCTTTAAAGTGGAATCAAAGG - Intronic
1024823680 7:53364435-53364457 TGGCATTAAAAAGTAAGCAAAGG + Intergenic
1025597537 7:62950035-62950057 TTCCAATAAATAGAAAAAAAGGG + Intergenic
1026347329 7:69485469-69485491 TTGGTTTACACAGGAAACAATGG + Intergenic
1027964010 7:84982077-84982099 ATGTATCAAATATGAAACAACGG - Intergenic
1028328952 7:89564223-89564245 TTTAATGAAATAGGAAATAACGG + Intergenic
1028576567 7:92358459-92358481 TTGTATTAAATAGCAAAAGAAGG - Intronic
1028710229 7:93898778-93898800 TGGGGTTAAATGGGAAACAAAGG - Intronic
1029116358 7:98239580-98239602 TTGGATTAAATGGGCAACATTGG - Intronic
1029925075 7:104307053-104307075 TGGCACTAAATAGTAAAGAATGG + Intergenic
1030855921 7:114557444-114557466 ATGCTCTAAATAGGAAAGAAAGG + Intronic
1031569089 7:123335865-123335887 TTCCATTAAAAAGTAAGCAAAGG + Intergenic
1032060618 7:128721759-128721781 TTTCAATAAATAGGAAGAAAGGG - Intronic
1033521042 7:142160579-142160601 TTGAGTTAAATAGGAGATAAAGG + Intronic
1038163108 8:25059294-25059316 TTGTATAAAATAGAAAACACTGG + Intergenic
1039436143 8:37560664-37560686 TTGCATTTGAGAGGAAAGAAGGG + Intergenic
1040818406 8:51532970-51532992 TTGAATCAAGTAGGAAAAAAAGG + Intronic
1040824839 8:51609590-51609612 TGGTAGGAAATAGGAAACAAAGG + Intronic
1040986487 8:53299492-53299514 TTGCATTAAAAAGTGAGCAAAGG - Intergenic
1041225711 8:55695806-55695828 TTGCATGAAATAGGAAAGGAGGG - Intergenic
1041271912 8:56117417-56117439 TGGAATTATATATGAAACAAAGG + Intergenic
1041714660 8:60922705-60922727 ATGTCTTAAAGAGGAAACAAAGG + Intergenic
1041936110 8:63333360-63333382 TTTAATAAATTAGGAAACAAAGG - Intergenic
1041954948 8:63548040-63548062 ATGCATCAAATAGTAAAAAATGG + Intergenic
1042096529 8:65222057-65222079 TTGCAATAAAGAGGAACTAATGG + Intergenic
1042584994 8:70326541-70326563 TTTCATAAAATATAAAACAAGGG + Intronic
1042967820 8:74374292-74374314 TTCCAATCAATAGAAAACAAGGG - Intronic
1043613587 8:82096077-82096099 TTGCAGCAAATAGAAAAAAAGGG - Intergenic
1043730857 8:83678746-83678768 TTTCATAAATTAGGAAACTAAGG + Intergenic
1043939315 8:86178935-86178957 TTCCATTTAATAAGAAAAAAGGG + Intergenic
1046328747 8:112685304-112685326 TTTTCTTAACTAGGAAACAAGGG + Intronic
1046546056 8:115651504-115651526 TTGCATTAAATAGGAACATAGGG - Intronic
1047118891 8:121877638-121877660 TTGAACATAATAGGAAACAATGG - Intergenic
1049530605 8:143152665-143152687 ATTCATTAAATAGGAAAATATGG + Intergenic
1049635450 8:143685929-143685951 TTGCATTACACATGAAACCACGG + Intronic
1051759892 9:20450630-20450652 TTGCATTAACTAGGCAATAGAGG - Intronic
1051820072 9:21154223-21154245 TTGCAGCAAAAAGGAAACAGAGG - Intergenic
1052012730 9:23430059-23430081 TTGCATTCCATCAGAAACAAGGG - Intergenic
1052106322 9:24521753-24521775 TAGCATTAAATAGGAAATAAGGG + Intergenic
1052605605 9:30695382-30695404 TTGGATTAAATTGGATGCAATGG - Intergenic
1052644151 9:31210788-31210810 TTTCAATAAATAGGAAATACTGG + Intergenic
1052750514 9:32484975-32484997 TTGGATTTAAAAGGAAAAAAAGG + Intronic
1053305739 9:36983584-36983606 TTGTTTTAAAGAGGAAACATTGG + Intronic
1053517844 9:38746579-38746601 TTTTATTAAATTGGATACAAGGG + Intergenic
1053541513 9:38978830-38978852 TTGTATTAAATAGTAAAGACTGG + Intergenic
1053805932 9:41801874-41801896 TTGTATTAAATAGTAAAGACTGG + Intergenic
1054624626 9:67385076-67385098 TTGTATTAAATAGTAAAGACTGG - Intergenic
1056729062 9:89148510-89148532 TTGCTCTAGACAGGAAACAATGG - Intronic
1057327673 9:94080570-94080592 TTGCATTTATTAGTAAAGAACGG - Intronic
1058286340 9:103184449-103184471 TGGCTTTAAATAGCAAACTATGG - Intergenic
1059895748 9:118862683-118862705 TTTCATTAAAAAGCAGACAAAGG - Intergenic
1060202328 9:121658618-121658640 TTGCATAAATAAGGAAGCAAGGG + Intronic
1060987343 9:127827341-127827363 TTTTATTTAATAAGAAACAAAGG + Intronic
1203391770 Un_KI270438v1:103547-103569 TTGAATTGAATGGGAACCAAAGG + Intergenic
1186818906 X:13266268-13266290 TTGCAATTAACAGGAATCAAAGG - Intergenic
1188074857 X:25762614-25762636 CTGTATTAAATTGGAAACAGGGG + Intergenic
1188393200 X:29646489-29646511 TGACATTTAAGAGGAAACAAAGG + Intronic
1188578890 X:31686497-31686519 AGGCATTAAATAAGAAACAAAGG - Intronic
1188854493 X:35176542-35176564 TTCCATCTAAAAGGAAACAATGG + Intergenic
1189486642 X:41438324-41438346 TGTCATTTAAAAGGAAACAAAGG + Intergenic
1190447353 X:50540390-50540412 AAGCATTAAAAAGGAAACAGAGG + Intergenic
1192388858 X:70703644-70703666 TGGCAGTAAATTGGAAAGAAAGG - Intronic
1192470615 X:71395672-71395694 TTACAGAAAAGAGGAAACAAAGG - Intronic
1193908950 X:87278914-87278936 TTCCAATCAATAGGAAACGAGGG + Intergenic
1193913770 X:87340403-87340425 TTACATTACACAGGCAACAATGG - Intergenic
1194080302 X:89454845-89454867 TTACATAAAATAGGAAAAAAAGG - Intergenic
1194196377 X:90898347-90898369 TTGCATAAAAAAAGAAACATAGG - Intergenic
1195611767 X:106874875-106874897 TTACATTAGATAGTAAAGAATGG + Exonic
1196413634 X:115447152-115447174 TTGCATTAAATAGGTTAAATTGG - Intergenic
1197280471 X:124529698-124529720 TTGAATTAATTAGGAAATAGAGG + Intronic
1197382102 X:125757969-125757991 TTGCCTTAAATAGACAGCAAAGG + Intergenic
1197660215 X:129162563-129162585 TTGGAGTACATAGGAAACAATGG + Intergenic
1198468891 X:136927991-136928013 ATGCATGAAAAAGAAAACAAGGG - Intergenic
1200432980 Y:3110908-3110930 TTACATAAAATAGGAAAAAAAGG - Intergenic
1200542220 Y:4472546-4472568 TTGCATAAAAAAAGAAACATAGG - Intergenic
1201097402 Y:10631900-10631922 TGGCATGGAATAGGACACAATGG - Intergenic
1202097554 Y:21267504-21267526 TTGCCTTAGGTAGGTAACAAGGG - Intergenic