ID: 1113184362

View in Genome Browser
Species Human (GRCh38)
Location 13:107670614-107670636
Sequence AAGAAATTATACGTGGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113184362_1113184365 0 Left 1113184362 13:107670614-107670636 CCATGGGCCACGTATAATTTCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1113184365 13:107670637-107670659 ACCAGCTCTTCTAGATTACAGGG 0: 1
1: 0
2: 2
3: 3
4: 109
1113184362_1113184364 -1 Left 1113184362 13:107670614-107670636 CCATGGGCCACGTATAATTTCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1113184364 13:107670636-107670658 TACCAGCTCTTCTAGATTACAGG 0: 1
1: 0
2: 1
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113184362 Original CRISPR AAGAAATTATACGTGGCCCA TGG (reversed) Intronic
904144514 1:28379243-28379265 AAGAAATTATAGGCTGGCCATGG - Intronic
909355453 1:74703642-74703664 AAGAAATTGTATGTGTGCCAAGG - Intergenic
913147708 1:116008497-116008519 AAGAGATGATACTTGGCTCAAGG + Intronic
915738662 1:158101279-158101301 AAGAACCTATAGGTAGCCCAAGG + Intergenic
915772585 1:158443996-158444018 AAGAAGTTAAACCTGGCACAAGG + Intergenic
916570030 1:166017089-166017111 AGGAAATTATACCTGTTCCATGG - Intergenic
917402021 1:174660337-174660359 AAGAAACTATTCCAGGCCCAAGG + Intronic
917840731 1:178975324-178975346 GAGAATTTATACCTAGCCCAGGG + Intergenic
920941909 1:210491499-210491521 AAGAAATAATAACTTGCCCAAGG - Intronic
923867760 1:237958373-237958395 AAGAAATTATATATGTTCCAGGG + Intergenic
1066028944 10:31397616-31397638 AACAAATTATATATAGCCCATGG + Intronic
1069383775 10:67865727-67865749 ATGAAATTATGAGTGGGCCATGG - Intergenic
1073610860 10:104941347-104941369 AAGAATTTTTACATGGCCCAAGG - Intronic
1075576346 10:123580457-123580479 AAGAAATTCTTCCTGGGCCAGGG + Intergenic
1083326980 11:61877886-61877908 AAGAAATTCTACGTGGGGCTTGG + Intronic
1089284622 11:117397438-117397460 AAGTAAATATAAGTGACCCAGGG - Intronic
1090370724 11:126249928-126249950 AAGAAAATAAACCTGGCCAAGGG - Intronic
1093497325 12:19773226-19773248 AACAAATTATTAGTGGCCTAAGG + Intergenic
1095796918 12:46229842-46229864 AATAAACTATAAGTGCCCCAAGG + Intronic
1098036883 12:66312410-66312432 AAGATATGATAAGTGGCTCATGG - Intronic
1099913759 12:88865741-88865763 AAGAAATTATACGGCTCCCTGGG - Intergenic
1100683920 12:96964433-96964455 ATGAATTTATACGTGACACAAGG + Intergenic
1108059559 13:46519109-46519131 AAAACATTAAAAGTGGCCCAAGG + Intergenic
1109567486 13:64136188-64136210 AAGAAATCATAGGTGACACATGG + Intergenic
1110430836 13:75421255-75421277 GAGAGATTGTACGTGGCCAAAGG - Intronic
1113184362 13:107670614-107670636 AAGAAATTATACGTGGCCCATGG - Intronic
1115487413 14:33925313-33925335 AACAATTTATAAGTGTCCCATGG - Exonic
1122778556 14:104133935-104133957 ATAAAATTATACAAGGCCCATGG - Intergenic
1123825212 15:24074579-24074601 AAAAAATTATATTTGTCCCATGG - Intergenic
1127066609 15:55246464-55246486 AAGACATTATTTGTTGCCCAAGG + Intronic
1127241054 15:57114586-57114608 AAAACATTATACGTGGGGCATGG - Intronic
1144198983 17:12922376-12922398 ATGCAATTTTACGTGGCACAAGG - Intronic
1148477662 17:47939985-47940007 AAGAAATAATACATGTCTCAAGG - Intergenic
1153062991 18:1013295-1013317 AAGAAAAAATACGTGGTTCATGG - Intergenic
1153391012 18:4559528-4559550 AAGAAATAATACATGGCCATTGG + Intergenic
1153822842 18:8847080-8847102 ATGAGATAATACGTGGCACATGG - Intergenic
1155635032 18:27942522-27942544 AAGAAATTAAACATGGCCAGAGG - Intergenic
1158039637 18:53077228-53077250 ATGAAATTATAAATGGCTCAAGG - Intronic
1159242061 18:65753967-65753989 CATAAATCACACGTGGCCCAAGG + Intronic
1160626422 18:80210664-80210686 AACAAAATAAACTTGGCCCATGG - Intronic
1168555446 19:57335320-57335342 AAGAAATTATCTGTGACACATGG + Intergenic
932192622 2:69753725-69753747 AGGAAATAATAAGTGGTCCAAGG - Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
938401730 2:130998484-130998506 AAAAAATTATCAGTGGCCAAAGG - Intronic
938694122 2:133819822-133819844 AAGAAAGTATGCTGGGCCCAAGG - Intergenic
941241946 2:163050122-163050144 AAGAAATTAGAAGTGCCCAAGGG - Intergenic
944091679 2:195918753-195918775 AGGAAATTATATGTGGAGCAAGG + Intronic
944455949 2:199894212-199894234 AAGAAATAATTTTTGGCCCAAGG - Intergenic
945962780 2:216152889-216152911 AAGAAATTATTAGTGGCCTAAGG - Intronic
947653057 2:231803456-231803478 AAGAAATAAGACTTGGCCCAGGG - Intronic
1169872377 20:10261765-10261787 AAGAAAACATAAGAGGCCCAGGG + Intronic
1170086603 20:12539727-12539749 AAGAAATTATAGATGACACAAGG + Intergenic
1172813197 20:37665802-37665824 TAGAACTAATACGTGGACCAAGG - Intergenic
1176836899 21:13801448-13801470 TAGAAATTATACGGGGGCCTTGG + Intergenic
1178426156 21:32479910-32479932 AAGAAAATATAGGTTTCCCAGGG + Intronic
1182880176 22:33726321-33726343 AAGAAATGACACATGGCCCTGGG + Intronic
949279223 3:2326815-2326837 AAGAAAGAATACTTTGCCCAGGG + Intronic
951658853 3:25039847-25039869 AGAAAATTAGACGTGGCCCATGG + Intergenic
952219490 3:31310786-31310808 AAGAAATTAGGCCAGGCCCAGGG - Intergenic
955565535 3:60240580-60240602 ACGAAATTATATTTGGACCAAGG - Intronic
958820947 3:98973200-98973222 AAGAAATTAAATATGGCCCTTGG - Intergenic
961231642 3:125318000-125318022 AGGAAATTTTACCAGGCCCATGG + Intronic
966525643 3:180916373-180916395 ATGAAATTATACTCAGCCCAAGG - Intronic
967775028 3:193377557-193377579 CAGAAACTACACGTGGCCCATGG + Intronic
975360078 4:73459017-73459039 AAGAAAATATATATAGCCCATGG - Intergenic
976187570 4:82457815-82457837 AAGAAACTATAAGTGGTCTAAGG - Intronic
980191905 4:129535593-129535615 AAGAAGTTAAACGTAGCACAAGG - Intergenic
980245258 4:130230708-130230730 ATGAAATTATCAGTGGACCAGGG + Intergenic
983050876 4:163046203-163046225 AAGAAATTAAAACTGGCACATGG + Intergenic
984580913 4:181509104-181509126 AAGAAACTACACGTGGAACATGG + Intergenic
987216174 5:15739565-15739587 AAGAGATTATAGGTTGCCTAAGG - Intronic
990635147 5:57717531-57717553 AATAAATTAGAAGTGGACCAAGG + Intergenic
990705748 5:58527556-58527578 AAGAAATTATATGGCACCCAGGG - Intergenic
992236750 5:74717614-74717636 AAAAAATTGTATGTGGTCCATGG - Intronic
993319016 5:86449244-86449266 ATGAAATTATACTTGAACCATGG - Intergenic
995450370 5:112293485-112293507 AAAATATTATACATGACCCATGG + Intronic
995794270 5:115925121-115925143 ATGAAAGTAAAAGTGGCCCAAGG + Intergenic
1000473005 5:161669839-161669861 AAGAAACTATACCTGTCTCAAGG - Intronic
1001093981 5:168762063-168762085 AAAAAATTATAGCTGGGCCATGG - Intronic
1005168386 6:22952403-22952425 AAGAAAGTCTATGTGGCACATGG - Intergenic
1008885523 6:56428641-56428663 AAGACATTATGCCTGGCCCAGGG + Intergenic
1024960991 7:54976231-54976253 AAGAATTTATACGTTTCCAATGG + Intergenic
1028698665 7:93749326-93749348 AAGAGAGTATATGTAGCCCAAGG + Intronic
1029671764 7:102037650-102037672 AAGAAATTCTACCCAGCCCAGGG - Intronic
1029815607 7:103091533-103091555 ACAAAATTATACTTGGCCTAAGG - Intronic
1031265918 7:119579969-119579991 AAGAAAGTCTATGTGGCCCTAGG - Intergenic
1031840336 7:126729693-126729715 AAGAAATCATAGGTGACACAAGG - Intronic
1033990741 7:147283011-147283033 AAGAAATTATTGGTGGACTATGG - Intronic
1038882939 8:31634770-31634792 AATAAATGATACGTTGCCCCCGG - Intergenic
1040606140 8:48933323-48933345 AATAAATTATACCTGTCTCAGGG - Intergenic
1040907690 8:52485822-52485844 GAGAAATCATACGTGCCACAGGG - Intergenic
1042259170 8:66839088-66839110 AAAAAATAACACGTGGACCAAGG + Intronic
1045913735 8:107441710-107441732 ATGAGATTATACGTGGTTCAGGG + Intronic
1051290367 9:15539283-15539305 AAGAAGTTATACACTGCCCAGGG + Intergenic
1052401706 9:28008929-28008951 AAGAAATTATAAGGAACCCAAGG + Intronic
1059897149 9:118879036-118879058 AAGAAATGATATTTGGCTCATGG + Intergenic
1060904372 9:127291658-127291680 CAGAAAGTAGGCGTGGCCCAAGG - Intronic
1186642867 X:11474407-11474429 ACCAAATTATAAGTGGACCAAGG + Intronic
1191612627 X:63133449-63133471 AAGAAATTATTTGTGGACAAAGG - Intergenic
1191623670 X:63245477-63245499 AAGAAATTATTTGTGGACAAAGG + Intergenic
1195556111 X:106226846-106226868 AATAAATTATACCTGACCAAAGG - Intergenic
1198994192 X:142555059-142555081 AAGAAATTACACAGGGCACAAGG + Intergenic
1199551402 X:149065479-149065501 AACTAATTATACAAGGCCCAGGG + Intergenic