ID: 1113191115

View in Genome Browser
Species Human (GRCh38)
Location 13:107747314-107747336
Sequence AGTTAGTTGTACAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 435}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113191115_1113191119 -2 Left 1113191115 13:107747314-107747336 CCTGCCATCTTGTACAACTAACT 0: 1
1: 0
2: 0
3: 37
4: 435
Right 1113191119 13:107747335-107747357 CTTCAAATGGTGCTTCTTTTGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1113191115_1113191121 23 Left 1113191115 13:107747314-107747336 CCTGCCATCTTGTACAACTAACT 0: 1
1: 0
2: 0
3: 37
4: 435
Right 1113191121 13:107747360-107747382 GCTCAAACTTTCCACCAGATGGG 0: 1
1: 0
2: 4
3: 14
4: 204
1113191115_1113191120 22 Left 1113191115 13:107747314-107747336 CCTGCCATCTTGTACAACTAACT 0: 1
1: 0
2: 0
3: 37
4: 435
Right 1113191120 13:107747359-107747381 TGCTCAAACTTTCCACCAGATGG 0: 1
1: 0
2: 1
3: 20
4: 211
1113191115_1113191118 -3 Left 1113191115 13:107747314-107747336 CCTGCCATCTTGTACAACTAACT 0: 1
1: 0
2: 0
3: 37
4: 435
Right 1113191118 13:107747334-107747356 ACTTCAAATGGTGCTTCTTTTGG 0: 1
1: 0
2: 1
3: 11
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113191115 Original CRISPR AGTTAGTTGTACAAGATGGC AGG (reversed) Intronic
901444625 1:9300522-9300544 AGTTATTTGTGGATGATGGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904712721 1:32442846-32442868 AGTTAGCTGGACACGGTGGCAGG + Intergenic
904727556 1:32561173-32561195 AGTAAGTTGTTCAATATGGCTGG - Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906783359 1:48592184-48592206 AGTTAATTGTGCAAGGGGGCAGG - Intronic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
908240798 1:62187553-62187575 AGTTAGCTGGACATGGTGGCAGG - Intergenic
908284372 1:62578571-62578593 AATTAGTTGGACATGGTGGCGGG + Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910141286 1:84029987-84030009 AGTTATTTGTGAAGGATGGCAGG - Intergenic
910223661 1:84915244-84915266 AGTTAGCTGGGCATGATGGCGGG - Intergenic
910227063 1:84946734-84946756 AGTAACTTGTACAAGATCACAGG + Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
913297059 1:117332340-117332362 AATTAGCTGCACATGATGGCAGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916621826 1:166506148-166506170 AGTTAGCTGGGCATGATGGCGGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917814009 1:178688991-178689013 AATTAGCTGGACATGATGGCGGG + Intergenic
918169582 1:181983726-181983748 AGTAAGTGGTACAGGGTGGCAGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920164079 1:204023266-204023288 AATTAGCCGTGCAAGATGGCAGG + Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921524243 1:216197483-216197505 TATTATTTGTCCAAGATGGCTGG + Intronic
921789593 1:219274532-219274554 AGTTAGTTGGGCATGGTGGCAGG - Intergenic
922362192 1:224833487-224833509 AGTGAGTTGTCCAAGATCCCAGG - Intergenic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924448488 1:244156327-244156349 AGATTGTTGTACAGTATGGCTGG - Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066344978 10:34575745-34575767 AGTTAGCTGGACATGGTGGCGGG + Intronic
1066551958 10:36568512-36568534 AGTTAGCTGGACATGCTGGCGGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073320667 10:102614407-102614429 AATTAGCTGGACATGATGGCAGG + Intronic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074319766 10:112391228-112391250 AGTTAGTTGCGCATGGTGGCAGG + Intronic
1075111303 10:119587204-119587226 AATTAGTCGTAAGAGATGGCAGG - Intronic
1076718590 10:132382010-132382032 CCTTGGTTGTACAAGAAGGCTGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077917102 11:6618553-6618575 CGTAAGTTGTACTAGATGCCTGG + Intronic
1078165360 11:8878536-8878558 AATTAGTTGGTCATGATGGCAGG - Intronic
1080142090 11:28933814-28933836 AGTTAGTTTTCCCAGATGTCTGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081640731 11:44751776-44751798 AATTATTTGGACATGATGGCAGG + Intronic
1081726779 11:45335569-45335591 AGTGAGTGGTGCAAGAAGGCTGG + Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083469632 11:62874909-62874931 AATTAGTCGCACACGATGGCGGG - Intronic
1085618164 11:78017591-78017613 AATTAGTTGGGCATGATGGCAGG - Intronic
1087826147 11:102767043-102767065 AGTGAGTTGTCCCAGATTGCAGG - Intergenic
1088101364 11:106159634-106159656 AATTAGCTGGACATGATGGCAGG + Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092588693 12:9928316-9928338 AATTAGCTGTGCATGATGGCAGG + Intronic
1092749167 12:11702387-11702409 ATTGATTTGTACAAGATAGCTGG + Intronic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095054617 12:37584624-37584646 AGTTAGCTGGACATGGTGGCAGG - Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096169286 12:49454009-49454031 AGTTAGTTGGGCATGGTGGCGGG - Intronic
1096345735 12:50844520-50844542 AATTAGCTGGACATGATGGCAGG - Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096990996 12:55803185-55803207 TGTAGGTTGTACAAGATGGCTGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100106877 12:91186003-91186025 AGTTACTTGTACAAGGTACCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102279713 12:111609300-111609322 AATTAGTTGGGCATGATGGCGGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103164247 12:118756673-118756695 AGTTAATTGGAGAAGATGGATGG - Intergenic
1104230093 12:126876362-126876384 ACTTAGTTGGGCATGATGGCGGG + Intergenic
1107721325 13:43251529-43251551 AGTGGGTTGTTCAAGATGGTTGG + Intronic
1108487004 13:50936850-50936872 AGTTCGGTGTACAAGAGGGAAGG - Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112934107 13:104777857-104777879 AGTTAGCTGTGCATGGTGGCAGG - Intergenic
1113191115 13:107747314-107747336 AGTTAGTTGTACAAGATGGCAGG - Intronic
1113489949 13:110683686-110683708 AGGTAGTTTTAGAAGATGACTGG - Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115209938 14:30957007-30957029 AATTAGTTGTGCATGATGGCAGG + Intronic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116960547 14:50963879-50963901 AATTAGTTGGGCATGATGGCGGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117454809 14:55886388-55886410 AGTGAGTAGTGGAAGATGGCTGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118385505 14:65252570-65252592 AGTTATTTGTGAATGATGGCAGG + Intergenic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1122679248 14:103444626-103444648 AATTAGCTGGACATGATGGCGGG + Intronic
1123929502 15:25156436-25156458 AGTTAATTGAGCAAGATTGCTGG + Intergenic
1124346553 15:28926405-28926427 AGGTAGTTGTACTAAATGGGAGG - Intronic
1126612177 15:50540770-50540792 AATTAGTTGGACATGGTGGCGGG - Intronic
1126812537 15:52422434-52422456 ATTGAGATGTAGAAGATGGCAGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129636691 15:77326139-77326161 AGTTAATTGTTCAAGATAGATGG - Intronic
1129734966 15:77954969-77954991 AGTTAGCTGGACATGGTGGCGGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133336418 16:5009470-5009492 AGTTAGTTGGACATGGTGGCGGG - Intronic
1135476689 16:22782677-22782699 AGTGAAATGTAAAAGATGGCAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136707922 16:32204559-32204581 AGTTAGCTGGGCAAGGTGGCAGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141019463 16:80481474-80481496 AGCAAGCTGGACAAGATGGCTGG + Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142377914 16:89716440-89716462 AGTAAGATGGACAAGATGGGAGG - Exonic
1142771261 17:2098777-2098799 AATTAGTTGGACATGGTGGCGGG - Intronic
1143160882 17:4870054-4870076 AGTTAGCTGGGCATGATGGCGGG - Intronic
1143777798 17:9210755-9210777 AATTAGCTGTGCATGATGGCAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1146850931 17:36221013-36221035 AGTTATCTGAACTAGATGGCAGG - Intronic
1147285119 17:39396445-39396467 AATTAGTTGTGCATGGTGGCGGG + Intronic
1147295165 17:39476560-39476582 AATTAGTTGAACATGGTGGCAGG - Intronic
1148044007 17:44731302-44731324 AGTTACTTGTAAAAGAAGTCTGG - Intronic
1148501264 17:48093115-48093137 AATTAGTTGGGCATGATGGCAGG + Intronic
1148669278 17:49398312-49398334 AATTAGTTGGACATGGTGGCAGG - Intronic
1150594302 17:66590699-66590721 AATTAGCTGGACATGATGGCGGG + Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151146717 17:72047978-72048000 AGTTACTTGTCCAAGATCACAGG - Intergenic
1151621522 17:75248320-75248342 AGTTAGCTGGGCAAGGTGGCGGG + Intronic
1151628351 17:75292328-75292350 AATTAGCTGGACATGATGGCGGG - Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154504214 18:15019799-15019821 AATTAGTTCAACAAGATTGCAGG - Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1158595350 18:58811023-58811045 AATTAGTTGGGCATGATGGCAGG - Intergenic
1158741904 18:60152760-60152782 AGATAGTTGTAAAAGATTGTAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159762446 18:72445010-72445032 AGTTAGTTTTACAACTTGGATGG - Intergenic
1160700451 19:504410-504432 AGTTAGCTGGACATGGTGGCAGG - Intronic
1161150542 19:2705989-2706011 AGTTAGCTGGACATGATGGTGGG - Intergenic
1162359333 19:10208336-10208358 AATTAGCTGGACATGATGGCAGG + Intronic
1163371224 19:16902366-16902388 AGTTAGTTGGGCATGATGGCGGG + Intronic
1163418054 19:17198584-17198606 AATTAGTTGGGCATGATGGCAGG + Intronic
1164500118 19:28812224-28812246 AGTTAGTTGGGCGTGATGGCGGG - Intergenic
1165971119 19:39630813-39630835 AGTTTCTTGTATAAAATGGCTGG - Intergenic
1166402324 19:42492533-42492555 AATTAGCTGGACATGATGGCGGG + Intergenic
1167126259 19:47551186-47551208 AGTTAGTTGGACATGGTGGCAGG - Intronic
1167657483 19:50774832-50774854 AGTTAGCTGGACATGATGGTGGG - Intergenic
1167827884 19:51990265-51990287 AATTAGTGGGACATGATGGCAGG + Intergenic
1168023058 19:53623799-53623821 AATTAGCTGGACATGATGGCAGG + Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925241168 2:2330837-2330859 AGTTATTTTTACAGCATGGCTGG - Intronic
929505044 2:42521901-42521923 AATTAGCTGGACATGATGGCAGG - Intronic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
933226100 2:79751295-79751317 AGTTAGAAATATAAGATGGCTGG + Intronic
933634681 2:84694415-84694437 AGGAAGTTGTACAAAATGGCTGG + Exonic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935555596 2:104506612-104506634 AATTAGCTGGACATGATGGCGGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935726481 2:106028456-106028478 AGTTGGTTCTCCAAGAAGGCTGG - Intergenic
935760550 2:106316707-106316729 AGTTAGCTGGACATGGTGGCAGG - Intergenic
936641221 2:114314661-114314683 AGTTATCTGGACAAGATGGGAGG - Intergenic
937014419 2:118591183-118591205 AGCCACTGGTACAAGATGGCAGG - Intergenic
938503402 2:131850000-131850022 AATTAGTTCAACAAGATTGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941212927 2:162665643-162665665 AGTTGCTTATACAAGATAGCAGG - Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942157656 2:173148104-173148126 AGTTAATCCTACAAGATGGAAGG + Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944813172 2:203348090-203348112 AGTTAGCTGGGCATGATGGCGGG + Intronic
945242747 2:207691236-207691258 AATTAGTTGGACATGATGGCGGG + Intergenic
945337344 2:208608280-208608302 AATTAATTGTACCAGATGGCAGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947776292 2:232713222-232713244 AATCAGTTGCACATGATGGCGGG - Intronic
1169634224 20:7669705-7669727 GGTTAGATGTCCAAGATGGCTGG + Intergenic
1170232808 20:14069095-14069117 AGTTAGCTGAGCACGATGGCGGG - Intronic
1171753037 20:29073876-29073898 AATTAGTTGTGCATGGTGGCGGG - Intergenic
1174456770 20:50654313-50654335 AATTAGTTGGGCATGATGGCAGG - Intronic
1174816448 20:53691341-53691363 AATTAGCTGGACATGATGGCAGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177164511 21:17584680-17584702 AGTTAGCTGGACATGGTGGCGGG + Intronic
1177469024 21:21531590-21531612 AGTAAGTTCTAAAATATGGCAGG + Intronic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177993015 21:28060137-28060159 AATTAGTTCAACAAGATTGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178533200 21:33392311-33392333 AGTTAGTTCTACAGGAGGGAGGG - Intergenic
1178571966 21:33746691-33746713 AATTAGCTGGACATGATGGCAGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1181999514 22:26908860-26908882 TGTGAGTTGTACAAGATGGGAGG - Intergenic
1182339563 22:29608518-29608540 ATTTAGTTGGGCATGATGGCGGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950577873 3:13843893-13843915 AGTTAGCTGGACAAGGTGGCGGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
951980802 3:28564274-28564296 AGGTACTGGTAGAAGATGGCAGG - Intergenic
952519243 3:34138683-34138705 AGTTGGGTCTAGAAGATGGCTGG - Intergenic
953444311 3:42949703-42949725 AATTAGTGGGACATGATGGCAGG - Intronic
953642196 3:44719120-44719142 AATTAGTTGGGCATGATGGCAGG - Intronic
953976896 3:47388811-47388833 AATTAGCTGGACATGATGGCAGG - Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955087119 3:55713688-55713710 AGTTCCTTGTACATGCTGGCAGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959654343 3:108784141-108784163 AATTAGCTGGACAAGGTGGCAGG + Intergenic
959711625 3:109391422-109391444 AATTAGATGGACATGATGGCGGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
964239312 3:154573517-154573539 AGTTAGTGGAGGAAGATGGCAGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965609547 3:170530243-170530265 AGCCAGTTGTACCAGATGTCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966946844 3:184782872-184782894 AGTTAGCTGTGCATGGTGGCAGG + Intergenic
967426496 3:189333236-189333258 AATTAGCTGTGCATGATGGCGGG + Intergenic
968309326 3:197670035-197670057 AGCTAGTTGGGCATGATGGCGGG - Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
969376197 4:6764899-6764921 AATTAGTTGGACATGGTGGCAGG + Intergenic
970217807 4:13778118-13778140 ACTTAGTTGGACAAGCTGTCTGG + Intergenic
970612620 4:17739701-17739723 AATTAGTTGAACATCATGGCGGG - Intronic
971334295 4:25708385-25708407 AGTTAGCTGGGCATGATGGCAGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972095490 4:35342661-35342683 AGTTACTTGCAGAAGACGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974337151 4:60563968-60563990 AGTCATTTGTACAACATGGATGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975453377 4:74557308-74557330 AGTTAGCTGGACATGGTGGCGGG - Intergenic
975795617 4:78003771-78003793 AGTTTCTTGTATAAAATGGCTGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976291565 4:83423760-83423782 AATTAGCTGTATATGATGGCGGG + Intronic
976644736 4:87375590-87375612 AATTAGCTGTACATGGTGGCGGG + Intronic
976905079 4:90227127-90227149 AGTTAGAAGTACGAGATTGCTGG - Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978985382 4:115005736-115005758 AGTTAGCTGGATAAGATGGTGGG + Intronic
979206169 4:118040823-118040845 AATTAGTTGGACATGGTGGCAGG - Intronic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
981011707 4:139931868-139931890 AATTAGTTGGGCATGATGGCTGG + Intronic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981894811 4:149786083-149786105 ATTTAGTTGTTCCAGATGGAAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982608728 4:157546767-157546789 AGTTAGCTGAGCATGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983522543 4:168725322-168725344 AGTAAGTTGTAAAAGATTTCTGG + Intronic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984240460 4:177212886-177212908 AGTTAGCTGTACATGAAGGACGG + Intergenic
986253824 5:6085239-6085261 AGTTAGTTCTGCAAGCTGCCGGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990172436 5:53068324-53068346 AGTTAGATGTGCTACATGGCAGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993485228 5:88475812-88475834 AGTTTGTTGTAGAGGGTGGCTGG - Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994351126 5:98747568-98747590 AATTAGCTGGACATGATGGCAGG + Intergenic
994595958 5:101835208-101835230 AGTTAGCTGGGCATGATGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994912583 5:105931509-105931531 AATTAGTTGGGCATGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994988241 5:106965529-106965551 AATTAGTTGGGCAAGGTGGCGGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996705537 5:126494230-126494252 AGTTGGTAGTAGTAGATGGCAGG - Intronic
997511433 5:134457522-134457544 AGTTAGCTGGGCATGATGGCGGG + Intergenic
997842191 5:137252072-137252094 AATTAGTTGGACATGGTGGCAGG - Intronic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
999599084 5:153240382-153240404 AATTAGTTGGACATGGTGGCAGG + Intergenic
999686588 5:154108484-154108506 AGTTAGTTGGGCATGGTGGCGGG + Intronic
999869403 5:155733394-155733416 AGTTTGCTGGACAAGATGTCTGG - Intergenic
1000148736 5:158479363-158479385 GGTGAGTTGTACCAGAAGGCAGG + Intergenic
1000197042 5:158969624-158969646 AATTAGTTGAACATGGTGGCAGG + Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003799213 6:9643268-9643290 AATTAGTTGGGCATGATGGCAGG + Intronic
1004360038 6:14962981-14963003 AATTAGTTGGACATGGTGGCAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006017388 6:31092779-31092801 AATTAGTTGGGCATGATGGCGGG + Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008533242 6:52484497-52484519 ACTTAGTAGTAGAAGATGACTGG + Intronic
1008954235 6:57197889-57197911 AATTAGCTGTGCATGATGGCAGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012272848 6:97236178-97236200 AATTAGCTGGACGAGATGGCAGG + Intronic
1012330859 6:97984740-97984762 AGTAAGTTTAACAAAATGGCAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013358956 6:109375466-109375488 AATTAGTTGGGCATGATGGCAGG + Intronic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013466630 6:110423090-110423112 AATTAGCTGGACATGATGGCAGG + Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017154197 6:151308359-151308381 AGTTAGCTGGGCATGATGGCAGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019426684 7:980997-981019 AGTTACTTTTAAAAGAGGGCTGG + Intergenic
1019677499 7:2323179-2323201 AATTAGCTGGACATGATGGCAGG + Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021893515 7:25211470-25211492 AGTTAGCTGGACATGGTGGCTGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1024256704 7:47544947-47544969 AGTTAGTTGTACGAAAAGCCTGG + Intronic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026479748 7:70767249-70767271 AGTAAGTTAAACAAGATGGGGGG - Intronic
1026771234 7:73201149-73201171 AGTTAGCTGGGCATGATGGCGGG + Intergenic
1027012102 7:74754546-74754568 AGTTAGCTGGGCATGATGGCGGG + Intronic
1027075939 7:75191508-75191530 AGTTAGCTGGGCATGATGGCGGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030351080 7:108488428-108488450 AATTAGCTGGACATGATGGCAGG + Intronic
1031862090 7:126992397-126992419 AGTTAATTGAGCAAGATTGCAGG + Intronic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032827910 7:135590258-135590280 AGTTAGCTGGGCATGATGGCGGG - Intronic
1033959875 7:146901709-146901731 AGTCAGTTGTATTAGATGGCTGG + Intronic
1034148092 7:148889898-148889920 AGTGAGTAATACAATATGGCTGG - Intergenic
1036405410 8:8450484-8450506 ACTTAGTTGGGCATGATGGCAGG + Intergenic
1036456069 8:8909109-8909131 AATTAGTTGTGCATGGTGGCAGG - Intergenic
1036806209 8:11836002-11836024 AGTTAGTTGGGCATGGTGGCAGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039705219 8:39999610-39999632 AATTAGTTGTGCATGTTGGCAGG - Intronic
1039874050 8:41570416-41570438 AATTAGCTGGACATGATGGCAGG + Intergenic
1041121125 8:54587275-54587297 AGTTAGCTGGACATGATGGTGGG + Intergenic
1041553209 8:59123085-59123107 ATTTAGTTATACAATACGGCAGG - Intergenic
1041709413 8:60879746-60879768 AATTAGCTGGACATGATGGCAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043783544 8:84367290-84367312 AATTAGTTGGGCAGGATGGCAGG - Intronic
1043878263 8:85510839-85510861 AGTTAGCTGGGCATGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045689680 8:104747359-104747381 AGTTAGTTGGGCATGGTGGCGGG + Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1049109173 8:140632697-140632719 AGTTAGTTGTTTAAGATGGGTGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054718590 9:68581628-68581650 AATTAGTTGGACATGATGGCGGG + Intergenic
1055253501 9:74337300-74337322 AGTAAGTTTTGCAAAATGGCAGG - Intergenic
1055328566 9:75158316-75158338 AATTAGCTGGACATGATGGCAGG + Intergenic
1055784598 9:79859209-79859231 AATTAGTTGGACATGGTGGCAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1060299019 9:122363177-122363199 AGTTAGCTGGGCAAGGTGGCGGG - Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1185599691 X:1330308-1330330 ATTTAGCTGGACATGATGGCAGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186860205 X:13665579-13665601 AATTAGCTGTGCATGATGGCGGG + Intronic
1187166646 X:16810616-16810638 AATTAGTTGTACAAGAGAGAAGG + Intronic
1187493986 X:19778280-19778302 AATTAGCTGGACACGATGGCGGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188158397 X:26770322-26770344 ACTTAGTTGTACCAGATTGTTGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189383067 X:40515696-40515718 AATTAGTTGGGCATGATGGCAGG + Intergenic
1189937292 X:46082798-46082820 AATTAGTTGGGCATGATGGCAGG - Intergenic
1190657782 X:52626915-52626937 AATTAGGTGTACATGGTGGCGGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196062531 X:111426584-111426606 AGAAATTTGAACAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199621284 X:149704059-149704081 AGTTAGCAGTGGAAGATGGCTGG - Intronic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201376236 Y:13323245-13323267 AATTAGTTGGGCATGATGGCAGG + Intronic
1202350737 Y:23987783-23987805 AGTTAGATGGGCATGATGGCAGG - Intergenic
1202520042 Y:25682337-25682359 AGTTAGATGGGCATGATGGCAGG + Intergenic