ID: 1113191472

View in Genome Browser
Species Human (GRCh38)
Location 13:107752691-107752713
Sequence GAGTCTGTAGTCTCTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113191472 Original CRISPR GAGTCTGTAGTCTCTTTGGA AGG (reversed) Intronic
901935211 1:12621863-12621885 GTGACTGCAGTCTCTTGGGAGGG - Intergenic
906030730 1:42718089-42718111 GAATCTGCAGACTCATTGGAGGG - Intergenic
906886085 1:49650620-49650642 GAGTCTGTGGTATATTTGCAGGG - Intronic
907115901 1:51968159-51968181 CAGTCTGTGTTCTCTCTGGAGGG - Intronic
908755557 1:67466144-67466166 GAGTTTGAGGTCTCTTTGTAAGG - Intergenic
914751443 1:150537706-150537728 GAGCCTGTTGCCTCTTGGGAGGG - Intergenic
919754152 1:201056308-201056330 AAGTCTGGAGTCTCTGAGGAAGG - Intronic
921064585 1:211613632-211613654 GAGTATGTAATCTGTTTGGATGG + Intergenic
922903171 1:229154265-229154287 GATTCTGCAGTTTCTATGGAGGG + Intergenic
923621662 1:235584468-235584490 AAGTCTGTAAACTTTTTGGAAGG - Intronic
924808939 1:247384267-247384289 GTGTCTGTAGCCCCATTGGAGGG - Intergenic
1066326632 10:34366809-34366831 AATTTTGGAGTCTCTTTGGAGGG - Intronic
1067176033 10:43946225-43946247 GAGTCTGTAGACACTTGAGAGGG + Intergenic
1071015109 10:80987755-80987777 GAGTCAGTATTCTCAGTGGAGGG + Intergenic
1071219190 10:83443985-83444007 GCAACTGTATTCTCTTTGGAGGG - Intergenic
1075138403 10:119808272-119808294 GAGTGTGTGCTCTCTCTGGAGGG + Intronic
1075327968 10:121549805-121549827 GAGGCTGAGGTCTCATTGGAAGG - Intronic
1075733181 10:124648353-124648375 GAGCCTGCAGTCTCCATGGAGGG + Intronic
1078149543 11:8746995-8747017 TAGTCTGTAGTTTCTTAGAAAGG - Intronic
1081526766 11:43932968-43932990 GAGGCTGGAGGCGCTTTGGAGGG + Intronic
1082037378 11:47656364-47656386 AATTCTGAAGTCTCTTTGGTAGG - Intergenic
1085137169 11:74102025-74102047 CAGTCTGAAGGCTATTTGGAAGG + Intronic
1085331800 11:75658326-75658348 GAGTTTGGGGTGTCTTTGGAAGG - Intronic
1085975344 11:81646422-81646444 TTGTCTGCTGTCTCTTTGGAGGG - Intergenic
1089136112 11:116250597-116250619 GACAATTTAGTCTCTTTGGAGGG + Intergenic
1090401302 11:126449976-126449998 GAGTCGGAAGTCTCTTTTGTCGG + Intronic
1090726520 11:129531838-129531860 GAGGCTGTAAGCTCTTTGAAGGG + Intergenic
1096853198 12:54456748-54456770 AATTCTCTAGTTTCTTTGGAAGG - Intronic
1098087636 12:66864261-66864283 GAGTTTATAGACTGTTTGGATGG - Intergenic
1098244820 12:68506248-68506270 GTGACTTTATTCTCTTTGGAAGG - Intergenic
1101473116 12:105017864-105017886 AAGTCTGTAGACTTTTGGGAAGG + Intronic
1103230117 12:119322613-119322635 CTTTCTGTAATCTCTTTGGATGG - Intergenic
1104768879 12:131347510-131347532 GAGACAGGAGTCTCTCTGGAAGG + Intergenic
1113191472 13:107752691-107752713 GAGTCTGTAGTCTCTTTGGAAGG - Intronic
1114722344 14:24896003-24896025 GAGTGTGGGGTGTCTTTGGAGGG + Intronic
1117303493 14:54450957-54450979 GAGTCTGTTGTCTTCTTGGCAGG - Intergenic
1127797587 15:62451804-62451826 GACTCTGTTTTCTCTTTTGATGG + Intronic
1128685059 15:69677991-69678013 GACTCTGTAATGTATTTGGAGGG + Intergenic
1129243522 15:74266064-74266086 GAAAATATAGTCTCTTTGGAGGG + Intronic
1129264289 15:74385730-74385752 GAGGCTGTTGTCCCTTTTGATGG - Intergenic
1129637754 15:77340357-77340379 TAGTATGTAGTCTCTTCAGATGG - Intronic
1129699881 15:77761758-77761780 GTGTCTGTAGCCTCTCTGCAAGG + Intronic
1132158112 15:99511013-99511035 AAGTTTGTAGTCTTCTTGGATGG - Intergenic
1140614643 16:76647234-76647256 AAGTCTGTAGGATCTTTGCATGG + Intergenic
1141647638 16:85376106-85376128 GAGTCTGTACCTTCTTTGGCGGG - Intergenic
1143043010 17:4053307-4053329 GTGTCTGTAGTGACTTTAGATGG - Intronic
1143751009 17:9027851-9027873 GGGCCTGTAGTCTCTTTCAAAGG + Intronic
1144387611 17:14763937-14763959 GTGTCTGTTTTCTTTTTGGAGGG + Intergenic
1144798591 17:17910176-17910198 GGGTCTGTAGCCTCCTTTGACGG + Intronic
1148995022 17:51701995-51702017 GATTCTGTAGTCTGGTTGGCAGG - Intronic
1150859528 17:68786972-68786994 GAATCTGTAATCTCTCTGGCAGG - Intergenic
1159264332 18:66060585-66060607 GAATGTGCAGTCACTTTGGAAGG + Intergenic
1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG + Intronic
1167469784 19:49669188-49669210 GGATCTGTATTTTCTTTGGATGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925985552 2:9212201-9212223 GAATATGTCCTCTCTTTGGAGGG + Intronic
926006027 2:9374125-9374147 GCTTCTGTAGGCTCTTTGGATGG + Intronic
929277112 2:40037830-40037852 GAGTCTGCATTCTCCTTGAATGG - Intergenic
931949756 2:67349665-67349687 GGGTCTGTAGCCTCTTTGTTTGG - Intergenic
932483232 2:72062533-72062555 TGGTCTGTGGTCTCTTAGGAAGG - Intergenic
932502494 2:72195643-72195665 CACTCTGTGGTCTCTTTGCAGGG - Intronic
932846086 2:75137131-75137153 GAGTATGTAGGCTGTTAGGATGG + Intronic
932991403 2:76792489-76792511 GAGTTTGTAGTATATTAGGAAGG + Intronic
936491559 2:112977032-112977054 GAGTCAGGAGACTCTTTGCAGGG + Intronic
940855899 2:158728553-158728575 GAGTCTGCAGGCTTTTCGGAAGG + Intergenic
942059528 2:172215436-172215458 GAGTCTGTAGTCTCATCGGGAGG + Intergenic
943397113 2:187353024-187353046 GAGACAGTAGTTTCTTTGGATGG + Intronic
943885209 2:193208067-193208089 GAGTCTAGAGTCTCTTTTAAAGG + Intergenic
948432129 2:237925960-237925982 CAGTCTGTAGTCATTTTGCAGGG + Intergenic
949022884 2:241751525-241751547 GAGAGAGTAGCCTCTTTGGATGG + Intronic
1172125827 20:32624693-32624715 GACTCTGTGGCCTATTTGGAGGG - Intergenic
1172796678 20:37544528-37544550 TAGTCTGTAGTCCCCATGGAGGG - Intergenic
1174388244 20:50199691-50199713 GAAACTGTAGTCTCTTAGTAGGG - Intergenic
1176335700 21:5596329-5596351 GAGTGTGTAGTCTCTTTTGTTGG - Intergenic
1176392057 21:6224619-6224641 GAGTGTGTAGTCTCTTTTGTTGG + Intergenic
1176469362 21:7091555-7091577 GAGTGTGTAGTCTCTTTTGTTGG - Intergenic
1176492923 21:7473333-7473355 GAGTGTGTAGTCTCTTTTGTTGG - Intergenic
1176507719 21:7665050-7665072 GAGTGTGTAGTCTCTTTTGTTGG + Intergenic
1178189262 21:30262078-30262100 GAGTCTGTAGTCTCTTTAAAAGG + Intergenic
1178839746 21:36129289-36129311 GCATCTGTTATCTCTTTGGAGGG - Intergenic
1181944165 22:26502805-26502827 GAGGCTGTAGTCTGTCTAGAAGG - Intronic
1182839947 22:33381208-33381230 GAGTTTGTAGGCTGGTTGGATGG - Intronic
1182999112 22:34840063-34840085 GAGTGTTTAGAGTCTTTGGAGGG + Intergenic
1183285615 22:36960853-36960875 GAATCTATTCTCTCTTTGGAAGG + Intergenic
1184767546 22:46579491-46579513 AAGCCTGTTTTCTCTTTGGAAGG + Intronic
949998911 3:9641442-9641464 GTGTCTGTAGTCCCATTGCAGGG - Intergenic
950527935 3:13535582-13535604 GAGACTGAAGTCTCTCCGGAGGG + Intergenic
951873825 3:27397571-27397593 AAGTATGTAGTCTCTTTGAAGGG - Intronic
954639386 3:52089003-52089025 CAATCTGCAGCCTCTTTGGAAGG + Intronic
957522112 3:81330775-81330797 ATGTCAGTAGTCTCTTTGGATGG - Intergenic
959527481 3:107393899-107393921 TAGTCTTTTTTCTCTTTGGAGGG - Intergenic
961601880 3:128068560-128068582 GAGCCTGCAGTCTCTTAGGAAGG + Intronic
962189885 3:133299420-133299442 GAGTTGGCAGTCCCTTTGGAAGG + Intronic
963776826 3:149448373-149448395 GAGGCTTTAGTCTCTTCGGCAGG - Intergenic
964368310 3:155972305-155972327 GAGCCTGTACTCTGTTTAGAAGG + Intergenic
965633107 3:170753526-170753548 GAGTCTGTTCTCTGTATGGAAGG + Intronic
971301141 4:25443238-25443260 GAGCCTGTGGTCACTGTGGAGGG + Intergenic
972376122 4:38472321-38472343 AAATCTGTGTTCTCTTTGGAAGG - Intergenic
972735017 4:41832029-41832051 GAGTCTGTGGACTCAGTGGATGG - Intergenic
975641572 4:76505780-76505802 GAGCCTGTAGTCTCTTTGGAAGG - Intronic
981215520 4:142161459-142161481 TACTCTGTAATCTCTTAGGAAGG + Intronic
981759234 4:148175004-148175026 AAGTCAGTAGTCCCTTTGTAAGG + Intronic
983927996 4:173422981-173423003 GATTATGTTTTCTCTTTGGATGG + Intergenic
984407299 4:179349819-179349841 GACTCTGTCGTCTCTATTGAGGG + Intergenic
987767442 5:22251210-22251232 GAGACTGGAGTCACATTGGAAGG + Intronic
987951535 5:24683052-24683074 GAGCCTGTAGTCTCTTTCTTTGG + Intergenic
990220113 5:53579099-53579121 GAGACAGTCATCTCTTTGGATGG - Intronic
990762858 5:59149814-59149836 GAGTCTGTTGTTCCTTTGCAAGG - Intronic
992068878 5:73131245-73131267 GTGTCTATGTTCTCTTTGGATGG + Intronic
992102717 5:73422618-73422640 GAGTAGGTGGTCTCTTTGCAGGG - Intergenic
992507745 5:77404986-77405008 GTCTTTGTCGTCTCTTTGGAGGG + Intronic
994410267 5:99399254-99399276 GAGTCTGGGGTTTCTTTGAATGG - Intergenic
994483554 5:100366022-100366044 GAGTCTGGGGTTTCTTTGAATGG + Intergenic
995465073 5:112443236-112443258 TAGTTTGTGGTGTCTTTGGAAGG - Intergenic
995639577 5:114239095-114239117 GAGTTAGTATGCTCTTTGGAGGG + Intergenic
999232802 5:150071766-150071788 GAATGTGTAGGCCCTTTGGAGGG - Intronic
1000541513 5:162547049-162547071 GATTCTGTAAGCTCTTTGAAGGG + Intergenic
1001424870 5:171616366-171616388 GAGGCTGTAATCAGTTTGGATGG + Intergenic
1003220929 6:4160419-4160441 GGGTCTGTAGCCTCTTTCCATGG + Intergenic
1004605672 6:17192999-17193021 GGGTCTGTAGTCTCTTTTTAAGG + Intergenic
1005407544 6:25505851-25505873 GAGACTTTTGTCTATTTGGAAGG - Intronic
1005880142 6:30050877-30050899 AATTATGTAGTCACTTTGGAAGG + Intergenic
1009388306 6:63113180-63113202 TGGGCTGTAGTCTCTTTGAAAGG - Intergenic
1011385696 6:86795856-86795878 GAGTTTGGAGACTTTTTGGAAGG - Intergenic
1011512477 6:88116224-88116246 GAATCTGGAGTCTCCCTGGAAGG - Intergenic
1014119309 6:117704856-117704878 GAGGCCATAGTCTATTTGGATGG + Intronic
1018167754 6:161115583-161115605 GAGTGTATAGTCTACTTGGAGGG + Intronic
1019774628 7:2905350-2905372 GAGTCAGGATTCTCTTAGGAAGG + Intergenic
1020974161 7:14984670-14984692 GAGTTTGTAGGCTGTATGGATGG - Intergenic
1023281292 7:38573072-38573094 TAGTCCGTACTCTCTTTTGAAGG + Intronic
1024977989 7:55131419-55131441 GAGTCAGTAATCTTTTAGGAAGG + Intronic
1029801329 7:102950747-102950769 CAGTATGTAGCCTTTTTGGATGG - Intronic
1030364167 7:108627134-108627156 GTGTCTGTAGCCTCATTGCAGGG - Intergenic
1030883321 7:114908361-114908383 CAGTCTGTGGTCTCATTTGAAGG + Intergenic
1032186531 7:129731479-129731501 GAGTCTTTGGTCTCTTAGGATGG + Intronic
1032893099 7:136220902-136220924 AAGTTTGCAGCCTCTTTGGATGG + Intergenic
1033089598 7:138373024-138373046 GAGTGTTAAGTCTCTTCGGAGGG + Intergenic
1035105852 7:156441051-156441073 GGGTCTGGAATCGCTTTGGAGGG - Intergenic
1036478769 8:9119146-9119168 GTGTCTATAGTATCTTGGGAGGG + Intergenic
1036563311 8:9916416-9916438 GACTCTGTGTTCTCTTTGCAGGG + Intergenic
1041527313 8:58821921-58821943 GAGTCTGTAGTCTCTGGGGCGGG - Intronic
1042253175 8:66776239-66776261 GAGACTGAAGTTTCTGTGGATGG - Intronic
1043226331 8:77735744-77735766 AAGTGTGGTGTCTCTTTGGAAGG - Intergenic
1044513821 8:93115475-93115497 GAGTCTGTGTTTTCTCTGGATGG - Intergenic
1046743231 8:117850316-117850338 GCGATTGCAGTCTCTTTGGAAGG + Intronic
1048127658 8:131655230-131655252 GAGTATGTGGTTTCTTTCGAGGG + Intergenic
1052964264 9:34327613-34327635 AAGTCTGTATGGTCTTTGGAAGG + Intronic
1056911979 9:90709379-90709401 AAATCTGAAGCCTCTTTGGAGGG - Intergenic
1058408254 9:104701872-104701894 GAGTATGTACTCTATTTTGAAGG - Intergenic
1058626727 9:106941199-106941221 GAGCCTGTACTCTCTTCTGAGGG + Intronic
1059121594 9:111644187-111644209 AAGTCTGACTTCTCTTTGGATGG - Intronic
1059778009 9:117495688-117495710 GGGTCTGTAGTCTCATTTCAAGG + Intergenic
1061109548 9:128558833-128558855 GAGGCTGTAGCACCTTTGGATGG + Intronic
1203425940 Un_GL000195v1:38573-38595 GAGTGTGTAGTCTCTTTTGTTGG + Intergenic
1186595265 X:10974429-10974451 GAGTCTGTGTTTTATTTGGATGG - Intergenic
1187021156 X:15383586-15383608 CAGTCTGGAATCTTTTTGGATGG - Intronic
1187096392 X:16152728-16152750 CATTCTGAAGGCTCTTTGGAGGG - Exonic
1187479800 X:19644896-19644918 GAGGCTCAAGTCTTTTTGGAAGG - Intronic
1194443885 X:93964147-93964169 GATTCTGTAGTTTCTTTATAGGG + Intergenic
1197614553 X:128676864-128676886 AACTCTCTAGTATCTTTGGATGG + Intergenic
1198963547 X:142205641-142205663 GAGGCTGTTGTCTCTGAGGAGGG - Intergenic