ID: 1113191854

View in Genome Browser
Species Human (GRCh38)
Location 13:107758102-107758124
Sequence TCTCCTCTATTCTGTTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 0, 2: 23, 3: 118, 4: 632}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113191853_1113191854 16 Left 1113191853 13:107758063-107758085 CCTTCAAAAGTGACAAGAGAAAA 0: 1
1: 1
2: 3
3: 53
4: 610
Right 1113191854 13:107758102-107758124 TCTCCTCTATTCTGTTACTGAGG 0: 1
1: 0
2: 23
3: 118
4: 632
1113191851_1113191854 20 Left 1113191851 13:107758059-107758081 CCACCCTTCAAAAGTGACAAGAG 0: 1
1: 0
2: 1
3: 16
4: 126
Right 1113191854 13:107758102-107758124 TCTCCTCTATTCTGTTACTGAGG 0: 1
1: 0
2: 23
3: 118
4: 632
1113191852_1113191854 17 Left 1113191852 13:107758062-107758084 CCCTTCAAAAGTGACAAGAGAAA 0: 1
1: 0
2: 1
3: 33
4: 510
Right 1113191854 13:107758102-107758124 TCTCCTCTATTCTGTTACTGAGG 0: 1
1: 0
2: 23
3: 118
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113191854 Original CRISPR TCTCCTCTATTCTGTTACTG AGG Intronic
900038736 1:438867-438889 TATCCTTCATTCTGTTAATGTGG - Intergenic
900060170 1:673846-673868 TATCCTTCATTCTGTTAATGTGG - Intergenic
900588474 1:3445733-3445755 TCTCCTTCACTCTGTTAATGTGG + Intergenic
901568449 1:10138862-10138884 TCTTCTCTATTCTGTTAATGTGG + Intronic
902492320 1:16792856-16792878 TCTTCTTTATTCTGTTACTGTGG + Intronic
903064464 1:20691166-20691188 TTGCCTGTAATCTGTTACTGGGG + Intronic
903309256 1:22440750-22440772 TTTCCTTCATTCTGTTAATGTGG + Intergenic
904462602 1:30689158-30689180 TCTCCTCTCTTCTACTTCTGAGG + Intergenic
904514227 1:31041135-31041157 TGTACTGTATTCTGTTTCTGTGG - Intronic
904596626 1:31650431-31650453 TATAGTCTCTTCTGTTACTGTGG - Intergenic
904815087 1:33190067-33190089 TCTCCTGTGTACAGTTACTGTGG + Intergenic
907006582 1:50920645-50920667 TCTCCTTTGTTCTGTTAATATGG - Intronic
907282128 1:53356359-53356381 TCTCCTTTATTTTGTTAATATGG + Intergenic
907538391 1:55187152-55187174 TGTCCTTTATTCTGTTACTATGG - Intronic
908220293 1:61999395-61999417 TCTCTTATATACTGTTAATGGGG - Intronic
908551226 1:65210560-65210582 TCTTGTCTTTTCTGTTACCGAGG + Intronic
908957052 1:69644846-69644868 TCTCCTTTATCCTGTTAATATGG - Intronic
908980123 1:69946243-69946265 TATCCTTCATTCTGTTAATGTGG + Intronic
909879581 1:80857086-80857108 TATCTTTTATTCTGTTAATGTGG - Intergenic
910152659 1:84170288-84170310 TCTCATCTATGCTTTCACTGAGG - Intronic
910295558 1:85641795-85641817 TATCCTTCATTCTGTTAATGTGG - Intergenic
910699309 1:90055892-90055914 TCTCCTTTAGTCTGTTAATGTGG - Intergenic
911264153 1:95723761-95723783 TCTCCTCTTTTCTGTAACTTTGG - Intergenic
911275895 1:95857775-95857797 TCTCCTTAATCCTGTTAATGTGG + Intergenic
911387993 1:97201818-97201840 TCTCATCTGCTCTGTAACTGTGG + Intronic
911436600 1:97867593-97867615 TGTCCTTTATTCTATTAATGTGG - Intronic
911564630 1:99449446-99449468 TGTTCTCTATTCTGTTACATTGG - Intergenic
911939718 1:104027193-104027215 TGTCCTTTATTCTGCTAATGTGG - Intergenic
912139566 1:106706210-106706232 TTTCCTCTATTCTCTTACTTTGG + Intergenic
913409061 1:118530988-118531010 TCTCCTCTATACTATTACTTTGG - Intergenic
914234863 1:145800027-145800049 TGTCCCTTATTCTGTTAATGTGG + Intronic
915258356 1:154653644-154653666 TTTCCCTTATTCTGTTAATGTGG + Intergenic
915986734 1:160473576-160473598 TGTCTTCTCTTCTGTTACTGTGG - Intergenic
916571755 1:166034174-166034196 ACTCCTCCATTTTGTTAATGAGG - Intergenic
916941006 1:169677704-169677726 TCTTCTCTAATCTGTTAATATGG + Intronic
917026547 1:170649598-170649620 TCTCTTCTATTCTCTTAAAGTGG + Intergenic
917985985 1:180319141-180319163 GCTCCTCTTTTCTACTACTGTGG + Intronic
918678012 1:187314202-187314224 TCTCCTCTATGCTTTAACTGAGG + Intergenic
918995400 1:191752441-191752463 TTTCCTCTATGCTGTTCTTGTGG + Intergenic
919053914 1:192545030-192545052 TATCCTCATTTCTGTTACTTAGG + Intergenic
919435024 1:197547340-197547362 TCTCCTCTACTCTGTGGCTGTGG + Intronic
919491106 1:198205916-198205938 TCTCTTCCATTGTGTTACAGTGG + Intronic
919521046 1:198587360-198587382 TTTCCTTCATTCTGTTAATGTGG + Intergenic
919562733 1:199142028-199142050 TTTTCTTTATTCTGTTACTGTGG - Intergenic
920042142 1:203106559-203106581 TTTCCTTTATTCTGTAAATGTGG + Intronic
920348699 1:205323318-205323340 TGTCCTCTATTCTCTTCCTCAGG - Intergenic
920595982 1:207270574-207270596 TCTCCTCTAGACAGTGACTGGGG + Intergenic
920833870 1:209489521-209489543 TCTACTCTCACCTGTTACTGCGG + Intergenic
921775504 1:219095473-219095495 TCTTCTCTATTGTGTTTGTGTGG - Intergenic
921784551 1:219214155-219214177 TCTTCTTCAGTCTGTTACTGTGG + Intergenic
922165953 1:223115985-223116007 TCTTCTCTCTGCTCTTACTGTGG + Intronic
923440450 1:234014210-234014232 TGTCCTTCATTCTGTCACTGTGG - Intronic
923528128 1:234789681-234789703 TCTTCTTTATTCTGTTACTGTGG - Intergenic
923873711 1:238023914-238023936 TCTCCTTTATTGTGTTATTTTGG - Intergenic
924389121 1:243532427-243532449 TCTCCTTCATTCTATTAATGTGG + Intronic
924561749 1:245162282-245162304 TCTCGTCTATGGTGTTATTGTGG + Intronic
924677964 1:246200060-246200082 TCTCCTCTACTCTATCACAGTGG - Intronic
924907988 1:248477321-248477343 TGTCATTTATTCTGTTAATGTGG + Intergenic
924916119 1:248570758-248570780 TGTCATTTATTCTGTTAATGTGG - Intergenic
1063773562 10:9232760-9232782 TATCCTCAAATCTCTTACTGGGG - Intergenic
1064799809 10:19056941-19056963 TATCCTTCATTCTGTTAATGTGG + Intronic
1065981931 10:30906830-30906852 TGTTCTCTATTCTATTAATGTGG + Intronic
1066349177 10:34621043-34621065 TCTCCAATGTACTGTTACTGGGG - Intronic
1066427401 10:35320338-35320360 TCTCCTTTGTTCTGTTAATATGG - Intronic
1067708186 10:48626767-48626789 TCCCCTCACTTCTGTTACTCAGG - Intronic
1068209126 10:53897502-53897524 TCTCCTCTTTTTCTTTACTGTGG + Intronic
1068388070 10:56358590-56358612 TCTCCTGTACTCTGCTCCTGGGG + Exonic
1068600453 10:58951281-58951303 TCTCATTTTTTCTGTCACTGAGG + Intergenic
1069280967 10:66652861-66652883 TGTCCTTTATTCTGTTAATGTGG - Intronic
1069349425 10:67507874-67507896 TGTTCTCCATTCTGTTAATGTGG - Intronic
1069423068 10:68264343-68264365 TCTCCTTTATTTTGTTAGTGTGG - Intergenic
1069936241 10:71919195-71919217 TCTTATCTTTTCTGTTACTCAGG - Intergenic
1070334560 10:75443450-75443472 TATCCTTTATTCTGTTAATGTGG + Intronic
1070480370 10:76876635-76876657 TCTCCTTTATTTAGTTGCTGGGG - Intronic
1071051349 10:81452702-81452724 TATTTTCTATTCTGTTTCTGTGG + Intergenic
1071112784 10:82180510-82180532 TATCCTTTATTCTGTTAATGTGG + Intronic
1071330891 10:84558951-84558973 TCTCCCTTATTCTGTTTATGTGG + Intergenic
1071405799 10:85330194-85330216 TCTCTTTTATTCTATTAATGTGG + Intergenic
1071950191 10:90694995-90695017 TCTTCTTTATTCTGTTACTATGG + Intergenic
1072142555 10:92602032-92602054 TTTCCTTCATTCTGTTAATGTGG + Intronic
1072831891 10:98667098-98667120 TCTATTCTATTCTATTTCTGTGG - Intronic
1073610978 10:104942660-104942682 TCTCCTTTATTATGTAATTGTGG - Intronic
1073904299 10:108259738-108259760 TCTCCCTTATTATCTTACTGTGG + Intergenic
1074217177 10:111396835-111396857 GCTCCTTTATTCTGTTAAGGTGG + Intergenic
1074227496 10:111500059-111500081 TCTCCCCTATTCTGTTAATGTGG - Intergenic
1074627287 10:115204555-115204577 TGTCCTTCATTCTGTTAATGTGG + Intronic
1074647312 10:115473112-115473134 TGTCCTTCATTCTGTTAATGTGG + Intronic
1075011895 10:118878979-118879001 TCTCCTTTATTCTGTAAATGTGG - Intergenic
1075034061 10:119048002-119048024 TCTGCTTTATTCTGTGTCTGTGG - Intronic
1075947502 10:126449258-126449280 TGTCCTTTATTCTGTTAATGTGG - Intronic
1075975703 10:126692177-126692199 TGTCCTTTATTCTGTTAATGTGG + Intergenic
1076222804 10:128748103-128748125 ACTCCTTTTTCCTGTTACTGGGG + Intergenic
1076964944 11:74780-74802 TATCCTTCATTCTGTTAATGTGG - Intergenic
1077493433 11:2872856-2872878 TCTCAGGTATTTTGTTACTGTGG - Intergenic
1078712150 11:13803813-13803835 CCTCCTTTATTCTGTTAATGTGG - Intergenic
1078824021 11:14909156-14909178 TCTCTTTTATTCTGTTAATGTGG + Intronic
1079179997 11:18183735-18183757 TCTCCTTTAATCTGTTAATGTGG + Intronic
1079483283 11:20906712-20906734 TTTCCTTTATTCTATTAATGTGG - Intronic
1079582714 11:22086366-22086388 TCACTTCTACTCTGTTTCTGAGG - Intergenic
1079691903 11:23428760-23428782 TCTTCTCTATTCTGTTCCATTGG + Intergenic
1081325635 11:41741019-41741041 TCCCCTTTGTTCTGTTAATGTGG - Intergenic
1081414752 11:42800993-42801015 TTTCCCCTATACTGTTCCTGTGG - Intergenic
1081415801 11:42813937-42813959 TGTCCTTTATTCTGTTAATGTGG - Intergenic
1081697851 11:45129032-45129054 TCTCCTTTATTCTGTTAATGTGG - Intronic
1081977208 11:47243167-47243189 TCTTCTCTGTTCGGTTCCTGCGG - Intronic
1082094564 11:48118673-48118695 TGTCCTCCATTCTGTTAATATGG - Intronic
1082907858 11:58331235-58331257 TATCCTTTATTATGTTAATGTGG + Intergenic
1083392689 11:62366339-62366361 TATGTTCTATCCTGTTACTGTGG - Intronic
1083395046 11:62384994-62385016 TATGTTCTATCCTGTTACTGTGG - Intronic
1083818741 11:65153531-65153553 TCTCCTGTAATCTGTTAAGGGGG + Intergenic
1085568300 11:77536026-77536048 TATCTTTTATTCTGTTAATGTGG - Intronic
1085634707 11:78149533-78149555 TTTCCTATATTTTGTTATTGGGG + Intergenic
1086829712 11:91544900-91544922 TCTCCTTTATTTTGTTAATGTGG - Intergenic
1087227626 11:95619892-95619914 TCTCCTCTTGTCTATCACTGTGG - Intergenic
1087381752 11:97413224-97413246 TGTCCTTTATTCTGTTGATGTGG - Intergenic
1087431646 11:98063906-98063928 TCAACTGTATTCTGATACTGTGG - Intergenic
1088310357 11:108453683-108453705 TGTCCTTTATTCTGTTAATGTGG + Intronic
1088690302 11:112320984-112321006 TCTGCTCTATCCTGTTTCTCGGG - Intergenic
1088867498 11:113862759-113862781 TCTCCTTCATTCTGTTGGTGTGG - Intronic
1088943488 11:114484638-114484660 TCACGTCTTTTCTGTTTCTGCGG + Intergenic
1089066349 11:115665117-115665139 ACTCCTCCATTCTTTTTCTGAGG + Intergenic
1089370994 11:117957398-117957420 TCTTCTCTATTCTGTTCCATTGG - Intergenic
1089799148 11:121010059-121010081 TTTCCTTTATTTTGTTAATGTGG - Intergenic
1089887011 11:121836147-121836169 TGTCCTTTATTCTGTTAATGTGG - Intergenic
1090209076 11:124904107-124904129 TCTCCTTTAATCTGCTAATGTGG + Intergenic
1091338229 11:134789633-134789655 TCTCCACTTTTCTTTTTCTGCGG + Intergenic
1091514653 12:1166656-1166678 TCTCCTGTATTCTGTTAATGTGG + Intronic
1091675729 12:2488057-2488079 TCTCCCCCATTTTGTTAGTGAGG - Intronic
1091830537 12:3546994-3547016 TCTCCTTTATTTTGTTAATGGGG - Intronic
1091964903 12:4731752-4731774 TGTCCTTCATTCTGTTAATGTGG + Intronic
1092441405 12:8508397-8508419 TCTCCTCTGTAGTGTGACTGTGG + Intergenic
1092650571 12:10630618-10630640 TATCCTTTATTCTGTTAATGCGG - Intronic
1093061233 12:14608044-14608066 TATCCTTGATTTTGTTACTGTGG + Intergenic
1093618632 12:21259810-21259832 TTTCCTTCATTCTGTTAATGTGG + Intergenic
1093633794 12:21440927-21440949 TGTCCTTTGTTCTGTTAATGTGG + Intronic
1093780463 12:23130504-23130526 GCTCCTCTATTTTGTTAATACGG + Intergenic
1093940268 12:25046089-25046111 TATGCTCCATTCTGTTAATGTGG - Intronic
1093974626 12:25407702-25407724 GGTTCTCTATTCTGTTCCTGAGG - Intergenic
1094759080 12:33508475-33508497 TATCCTGTATTCTTTTAATGTGG - Intergenic
1095132094 12:38555531-38555553 TATCCTCCATCCTGTTACTTTGG + Intergenic
1095150697 12:38792955-38792977 TGTTCTTTATTCTGTTAATGTGG - Intronic
1095394983 12:41752106-41752128 TCACCTCTAATCTGTTAATATGG + Intergenic
1095894857 12:47269913-47269935 TCTACTCTCTTCTTTTGCTGGGG + Intergenic
1096035259 12:48462605-48462627 TCTTCTTTATTCTGTTAATATGG - Intergenic
1097073210 12:56371761-56371783 TCTCCTTCATTCTGTTAATGTGG - Intergenic
1097386278 12:58953203-58953225 TCTCCTCAATTCTTTGACAGTGG + Intergenic
1097407551 12:59209560-59209582 TATCCTTTATTCTGTTAATATGG - Intergenic
1097515923 12:60605976-60605998 TTTTCTTTATTCTGTTATTGTGG - Intergenic
1097920219 12:65064078-65064100 TCTCCTCACTTCTGTTTCTCTGG + Intronic
1097950635 12:65423612-65423634 TGTCCTTCATTCTGTTAATGTGG + Intronic
1098006321 12:66000331-66000353 TCTCCTCTATTTTCTTATTTTGG + Intergenic
1098026321 12:66206491-66206513 TGTCCTTCATTCTGTTAATGTGG + Intronic
1098037395 12:66318209-66318231 TCTCCTGTTTTCTATTATTGTGG + Intronic
1099371524 12:81836334-81836356 TCTTCTTTATTCTGTTAATATGG - Intergenic
1099524412 12:83701822-83701844 TGTTCTCTATTCTGTTCCAGTGG - Intergenic
1099746754 12:86714490-86714512 TTTCCTCCATACTGTTCCTGTGG + Intronic
1099891235 12:88591242-88591264 TCTCCTATATTCTGGTAATATGG - Intergenic
1100342562 12:93694191-93694213 TGTCCTTCATTCTGTTAATGTGG - Intronic
1100873230 12:98935249-98935271 TATCTTTTATTCTGTTAATGTGG + Intronic
1100936063 12:99667814-99667836 CTTCCTTTATTCTGTTAATGTGG + Intronic
1101179864 12:102204100-102204122 TCTCCTGTATTCATTTACAGTGG - Intergenic
1101188365 12:102305621-102305643 TTTCATCTTTTCTGTTACTCAGG + Intergenic
1101190972 12:102332057-102332079 TATCTTCTATTCTGTTTCTCTGG + Intergenic
1101212760 12:102551127-102551149 TCTCCTTCATACTGTTACTTTGG + Intergenic
1101228705 12:102716777-102716799 TGTCCTTTATTCTATTAATGTGG + Intergenic
1101914717 12:108887239-108887261 TCTTCTTTATTCTATTAATGGGG + Intronic
1104236117 12:126938072-126938094 TCTCCTCTCTGCTATTACAGGGG - Intergenic
1105933810 13:25079006-25079028 TCTCCTCTATTCTATTCATATGG - Intergenic
1106238923 13:27892255-27892277 TTCTCTTTATTCTGTTACTGCGG + Intergenic
1106570674 13:30924573-30924595 ACTCCTCTCTTCTGCTTCTGTGG + Exonic
1106616348 13:31332630-31332652 TCTCCTTTATTCTATTAATGTGG - Intergenic
1107062849 13:36179377-36179399 TCTCCTTTATTCTGTTAATGTGG + Intronic
1107063401 13:36186166-36186188 TCTCCTCTTGTTTGTTAATGTGG - Intronic
1107131274 13:36898632-36898654 TCTCCTTTATTTTGTTAGTATGG - Intronic
1107179418 13:37441219-37441241 GGTCCTTCATTCTGTTACTGTGG + Intergenic
1107756250 13:43625612-43625634 TTTCCTCTAACCTGTTAATGTGG + Intronic
1107885889 13:44873846-44873868 TTTCCTCTAATCTGGTCCTGCGG - Intergenic
1108105969 13:47010294-47010316 TCTCATTTATTCTTTTAATGTGG - Intergenic
1110364398 13:74664932-74664954 TTTGGTCTATTTTGTTACTGGGG + Intergenic
1110858377 13:80321574-80321596 TCTCATCTATTCATCTACTGTGG + Intergenic
1110963098 13:81656255-81656277 TATCCTTTATTCTGTTAATGTGG + Intergenic
1111490478 13:88967149-88967171 TGTCCTCTATTCTGTTAATGTGG + Intergenic
1113191854 13:107758102-107758124 TCTCCTCTATTCTGTTACTGAGG + Intronic
1113353805 13:109557637-109557659 TGTCCTTCATTCTGTTAATGAGG - Intergenic
1113547870 13:111168248-111168270 TCTCATCTACTCTGTCTCTGCGG + Intronic
1113704479 13:112418419-112418441 TCTACACTATCCTTTTACTGAGG - Intronic
1114838912 14:26238855-26238877 TCTCCTATATTCTGTCCTTGTGG - Intergenic
1116386384 14:44335468-44335490 TCTTCTTTACTCTGTTAATGTGG - Intergenic
1117359321 14:54957868-54957890 TCTTTTATCTTCTGTTACTGCGG + Intronic
1117586811 14:57215537-57215559 TATCCTTCATTCTGTTAATGTGG - Intronic
1117845750 14:59910128-59910150 GGTTCTCTATTCTGTTACAGAGG + Intergenic
1118106027 14:62660486-62660508 TGTCCTTCATTGTGTTACTGTGG - Intergenic
1118546091 14:66890783-66890805 TTCCCTCCATTCTGCTACTGTGG - Intronic
1118696734 14:68393399-68393421 TGTCCTCTATTCTCATACTGAGG + Intronic
1119276785 14:73364055-73364077 CCTCCTTTATTCTGTTAATGTGG - Intronic
1119357222 14:74017757-74017779 GCACCTATAGTCTGTTACTGGGG + Intronic
1120487627 14:85134378-85134400 TATCCTTCATTCTGTTAATGGGG - Intergenic
1122014622 14:98784004-98784026 TTTCTTCTTTTCTTTTACTGTGG + Intergenic
1122055478 14:99095229-99095251 TCTCCTCTCTCCTGTGAGTGAGG - Intergenic
1124154439 15:27213168-27213190 TCTCCTCCTTTTTGTCACTGAGG - Intronic
1124223090 15:27866428-27866450 CCTCTGCTACTCTGTTACTGAGG - Intronic
1124508565 15:30302254-30302276 TATCCTTTATTCTGTTAATGTGG + Intergenic
1124734992 15:32236407-32236429 TATCCTTTATTCTGTTAATGTGG - Intergenic
1125007290 15:34832324-34832346 TCTCCTTTTTTCTGTTAATGTGG + Intergenic
1125113647 15:36063454-36063476 TTTCCTCTATTCTGTTCTTTAGG - Intergenic
1125275692 15:37988616-37988638 TTGCCTTTATTCTGTTAATGTGG + Intergenic
1125301670 15:38260925-38260947 TCTCCTCTATTCTCTTCTTTTGG - Intronic
1125313467 15:38405900-38405922 TCTCCTTTATTCTGTTAATGTGG - Intergenic
1125605611 15:40938257-40938279 TCTCTTCTCTTCTGTTCCTCTGG - Exonic
1125701282 15:41686748-41686770 TCTCCTTTATTTTGTTAATATGG + Intronic
1126356699 15:47803657-47803679 TCTCCTCAATTCTGAAACCGTGG - Intergenic
1126753046 15:51896951-51896973 TGTCCTTTATTCTGTCAATGTGG + Intronic
1126876628 15:53049468-53049490 TGTCCTCCATTCTGTAAATGTGG + Intergenic
1127316733 15:57802516-57802538 TATCCTTCATTCTGTTAATGTGG - Intergenic
1128523962 15:68396291-68396313 TCTCCTTCATTCTGTTAATATGG - Intronic
1128762823 15:70229437-70229459 TCCCCACTAGACTGTTACTGAGG - Intergenic
1128831532 15:70773588-70773610 TTGCCTTTATCCTGTTACTGCGG - Intergenic
1129573387 15:76714900-76714922 TCTCCTTTAATCCGTTAATGTGG - Intronic
1130372035 15:83293277-83293299 TCTCTCCTCTTCTGGTACTGTGG - Intergenic
1130802838 15:87283957-87283979 TTTCCTTTATTTTGTTAATGTGG - Intergenic
1131244104 15:90775024-90775046 TCTCCTCTATTCTCTTGCCAGGG - Intronic
1131451830 15:92547737-92547759 TCTACTTTATTCAGTGACTGGGG - Intergenic
1132100095 15:99016664-99016686 TCTCCTCTATTTTGTAGATGAGG - Intergenic
1132159763 15:99529186-99529208 TATCCTTTATTCTGTTAATATGG - Intergenic
1132323881 15:100949735-100949757 TCTCCTTTATTCTATTAATATGG - Intronic
1132324385 15:100955757-100955779 TATCCTTTATTCTGTTAATGTGG + Intronic
1132407158 15:101550529-101550551 CCTTCTTTATTCTGTTAGTGTGG - Intergenic
1132443180 15:101888741-101888763 TATCCTTCATTCTGTTAATGTGG + Intergenic
1134503612 16:14788307-14788329 TCTCCTCTCTTCAGCTACTTGGG + Intronic
1134576956 16:15340591-15340613 TCTCCTCTCTTCAGCTACTTGGG - Intergenic
1134725483 16:16415901-16415923 TCTCCTCTCTTCAGCTACTTGGG + Intergenic
1134941949 16:18295957-18295979 TCTCCTCTCTTCAGCTACTTGGG - Intergenic
1135299055 16:21309882-21309904 TGTCCTTTATTCTGTTAATGTGG + Intergenic
1135426483 16:22341182-22341204 TGTCCTTCATTCTGTTAATGTGG - Intergenic
1135545450 16:23362856-23362878 TCTGCTCTGTTCTTTTCCTGTGG + Intronic
1136287064 16:29250597-29250619 TTTCCTCTATTCTGTTCTCGTGG + Intergenic
1137033397 16:35545612-35545634 GGTCCTCTATTCTGTTTCAGTGG - Intergenic
1137751961 16:50869920-50869942 TTTCCTCTATTTTGTTAATGTGG + Intergenic
1138612742 16:58140221-58140243 TCTCCTTTATTCTGTTAATGTGG - Intergenic
1138808135 16:60116877-60116899 TCTCCTTTATTTTGCTAATGTGG + Intergenic
1139025238 16:62808498-62808520 TCTCTTCTATTCTGTTGTTGGGG + Intergenic
1139146684 16:64333223-64333245 TATCCTCTATTCTGTTAATGTGG - Intergenic
1140060284 16:71563343-71563365 TGTCCTTCATTCTGTTAATGTGG + Intronic
1140568113 16:76068115-76068137 TCTAATTTATTCTGTTAATGTGG + Intergenic
1140936862 16:79679827-79679849 TCTCTTATATTCTGTTAATGTGG + Intergenic
1141210017 16:81969961-81969983 TATCCTCTGTTCTGTTCCTGTGG + Intergenic
1141342290 16:83214181-83214203 TCACCTCTTCTCTGTCACTGTGG - Intronic
1141796163 16:86276481-86276503 TCTCCTTTATTCTCTTTCAGTGG - Intergenic
1142092669 16:88223229-88223251 TTTCCTCTATTCTGTTCTCGTGG + Intergenic
1142909639 17:3077407-3077429 TATCCTTCATTCTGTTAGTGTGG + Intergenic
1142924859 17:3226408-3226430 TATCCTTCATTCTGTTAGTGTGG - Intergenic
1143435954 17:6925482-6925504 TGTCATTTATTCTGTTAATGTGG - Intronic
1143719228 17:8798544-8798566 TCTCCTCCATCCTGTCACTTCGG - Exonic
1144402874 17:14923545-14923567 TATTTTCTATTCTATTACTGGGG + Intergenic
1144611557 17:16723032-16723054 TCTCCTCTATTTTTTTTTTGAGG + Intronic
1144934013 17:18883211-18883233 TTTCCTTCATTCTGTTAATGTGG + Intronic
1144938796 17:18922013-18922035 TTACCTCTTTTCTGTTTCTGTGG + Intronic
1145100294 17:20070381-20070403 TGTCCTTTATTCTATTACTAGGG + Intronic
1145115677 17:20209052-20209074 TCTCCTCTAACTTGTTAGTGAGG + Intronic
1145131324 17:20353755-20353777 TCTCCTCTATTTTTTTTTTGAGG + Intergenic
1145786277 17:27595822-27595844 TCTCCTCTGTGCTGTGGCTGGGG + Intronic
1146470804 17:33122943-33122965 TCACCTCTCATCTGTTACAGTGG + Intronic
1146732541 17:35206556-35206578 TGTCTTTCATTCTGTTACTGTGG + Intergenic
1149547724 17:57516850-57516872 TTTCTTTTATTCTGTAACTGTGG + Intronic
1149717185 17:58803346-58803368 TATCCATTATTCTGTTATTGTGG + Intronic
1150111282 17:62502266-62502288 TCTCCTTTATTCTATTAATATGG - Intronic
1150123710 17:62623089-62623111 TCTCCTCTTCTCTGGTTCTGTGG - Intergenic
1150825039 17:68466718-68466740 TCTCCTATCTTATGTTAATGTGG + Intergenic
1151356379 17:73561035-73561057 TCTCCTCTTTCCTGTACCTGTGG - Intronic
1153422249 18:4919432-4919454 TCTCCTTTATTCTATTAATGTGG - Intergenic
1154224534 18:12490660-12490682 TATTCTTTATTCTGTTACGGTGG - Intronic
1154286761 18:13064663-13064685 GGTCCTCTATTCTGTTCCTTTGG + Intronic
1154938170 18:21082553-21082575 TGTCCTTTATTCTATTAATGTGG - Intronic
1155380214 18:25213415-25213437 TCTCTTTTAATCTGTTAATGTGG + Intronic
1155460458 18:26075451-26075473 TCTTCTTTAATCTGTTAATGTGG - Intronic
1155513643 18:26602228-26602250 TGTCCTTTATTCTATTACTATGG + Intronic
1156193664 18:34748637-34748659 AGTTCTCTATTCTGTTCCTGTGG + Intronic
1156835437 18:41547883-41547905 TCTCCACTAGTCTGTTACTGAGG - Intergenic
1156887009 18:42146869-42146891 TGTTCTCTATTCTGTTCCTTTGG - Intergenic
1157990150 18:52485581-52485603 TCTCCTGTATTTTGTAATTGGGG - Intronic
1157998976 18:52594076-52594098 TTTCTTCTATTCTTTTACTCGGG + Intronic
1158910706 18:62058827-62058849 TCAACTCTATTCTGTTTCTGAGG + Intronic
1159075080 18:63671804-63671826 TGTCCTTCATTCTGTTAATGTGG + Intronic
1159177581 18:64858261-64858283 TCTCCTTTAGTTTGTTATTGTGG + Intergenic
1159258850 18:65984239-65984261 TTTCCTTTATTCTGTTAATATGG + Intergenic
1159288458 18:66384570-66384592 TATCTTTTATTCTGTTAATGTGG - Intergenic
1159359359 18:67381169-67381191 TCTCCTCCATGCGGTGACTGTGG + Intergenic
1159501106 18:69271070-69271092 TGTCCTGAATTCTGTTAATGTGG - Intergenic
1160641749 19:144410-144432 TATCCTTCATTCTGTTAATGTGG - Intergenic
1161552676 19:4922982-4923004 TCCCCTCTCATCTGTTACTAGGG - Intronic
1162877687 19:13632862-13632884 TCTACCCTCTTCTGTTCCTGAGG - Intergenic
1164470161 19:28523279-28523301 TCCCATCTGTTCTGTTACTCAGG + Intergenic
1164482910 19:28628841-28628863 TATCCTCTATTCTGCTAATGTGG - Intergenic
1165005796 19:32805559-32805581 TGGACTCTATTCTGTTACTTTGG + Intronic
1165282808 19:34812699-34812721 TCTTCTTTATTCTCTTAGTGTGG - Intergenic
1165291141 19:34887263-34887285 TCTCCTTTATTCTCTTAATATGG - Intergenic
1165298782 19:34953335-34953357 TTTCCTTTATTCTGTTAATATGG - Intergenic
1165343788 19:35230518-35230540 TCTCCTTTATTCTGTTAATGTGG - Intergenic
1166250519 19:41566446-41566468 TCTCCTTTAGTCTGTTAATGTGG + Intronic
1167861372 19:52286649-52286671 TTTTCTTTATTCTGTTATTGTGG + Intronic
1168294328 19:55371244-55371266 TCTCCCCTTTTCTGTCCCTGGGG - Intergenic
1168533640 19:57150680-57150702 TCTCTTCTATCCTGTTGTTGGGG - Intergenic
925506502 2:4571048-4571070 TCCCCTTTATTCTATTAATGTGG + Intergenic
925733809 2:6943176-6943198 ACTCCTCTCTTCTTTCACTGGGG - Intronic
926262219 2:11275616-11275638 TTACCTTTATTCTGTTAATGTGG - Intronic
926385192 2:12328886-12328908 TCTCCACTTTTCTGGCACTGGGG + Intergenic
927106119 2:19828409-19828431 TCTCTTTTATTCTGTTAGTATGG - Intergenic
927229480 2:20807565-20807587 TTTTCTTTATTCTGTTAATGTGG - Intronic
928271768 2:29861999-29862021 TGTCCTTTATTCTTTTAATGTGG - Intronic
928386599 2:30873859-30873881 TCTTCTTTATTCTGTTAATGTGG + Intergenic
928643874 2:33330621-33330643 TCTTCTTTATTCTGTTAATGTGG + Intronic
928785348 2:34878177-34878199 TGTCCTTTATTCTGTAAATGTGG - Intergenic
929367728 2:41180829-41180851 TTTCCATTATTCTGTTAATGTGG - Intergenic
929465070 2:42137005-42137027 TTTCCTCTATTCCTTTACTGGGG - Intergenic
929743254 2:44627137-44627159 TCTCCTTTACTTTGTTAATGTGG + Intronic
929812025 2:45198178-45198200 TCTACTTTATTCTCTTAATGTGG - Intergenic
930968677 2:57366346-57366368 TGGCCTTTATTCTGTTAATGTGG - Intergenic
930992296 2:57671870-57671892 TATCCTTTATTCTGTTAATCTGG + Intergenic
931192079 2:60012365-60012387 TCTCTGATATTCTGTTAATGTGG + Intergenic
931296707 2:60934574-60934596 TGTCCTTCATTCTGTTAATGTGG + Intergenic
931567923 2:63635579-63635601 TATCCTTTATTCTGTTAATCTGG - Intronic
931578787 2:63750751-63750773 TCTTCATTATTCTGTTAATGTGG + Intronic
932041139 2:68301262-68301284 TCTCCTTTATTCTGTTAATATGG - Intronic
932258205 2:70304759-70304781 TCTCCTCTCTTCTCTCACTCAGG + Intergenic
932905817 2:75749833-75749855 TCTTCACTAATCTCTTACTGTGG - Intergenic
933289546 2:80422707-80422729 TCTCCTTTATTCTCTTTCAGAGG + Intronic
933474332 2:82770138-82770160 TATCTTCTATTCTGTTAATGTGG - Intergenic
933683224 2:85121701-85121723 TCTCCTTTATTCTATAATTGTGG + Intergenic
934726489 2:96623635-96623657 TCTCCTGGATCCTGTAACTGTGG - Intronic
934938395 2:98481607-98481629 TCCCCATTAATCTGTTACTGAGG - Intronic
935583854 2:104783416-104783438 TCTCTTCTTTGCTGCTACTGAGG - Intergenic
936027209 2:109041904-109041926 TCTCCTTTATTCTGTTAATGTGG + Intergenic
936231968 2:110710726-110710748 CCTCCTTTATTTTGTTACTGTGG + Intergenic
936969207 2:118160616-118160638 TATCCTATATTCTGTTAATGTGG - Intergenic
937194418 2:120138991-120139013 GCTTCTCTATTCTGTTACATTGG - Intronic
937777581 2:125797704-125797726 TATCCTCCTTTCTGTTAATGTGG - Intergenic
938027992 2:127967327-127967349 TCTCCTTTATTCTGTCACATGGG - Intronic
938068746 2:128295738-128295760 TTTCCTTCATTCTGTTAATGTGG - Intronic
938677201 2:133649610-133649632 AATCCTTTATTCTGTTAATGTGG - Intergenic
938844129 2:135191075-135191097 TGTCCTTTATTCTTTTAATGTGG - Intronic
939170466 2:138689412-138689434 TCTCCCCTACTCTGTTAATGAGG - Intronic
939204895 2:139088506-139088528 TATCCTTCATTCTGTTAATGTGG + Intergenic
939422368 2:141989652-141989674 TTTCCTCCATTCTGTTCTTGTGG + Intronic
940078615 2:149773347-149773369 TCTGCTCTACTCTGTTAATGTGG - Intergenic
940088601 2:149890996-149891018 TCCTCTCTATTCTGTTCCTTTGG - Intergenic
941254385 2:163209974-163209996 ACTCCTTTATTCTGCTTCTGGGG + Intergenic
941256342 2:163236521-163236543 TGTCCTTCATTCTGTTAATGTGG + Intergenic
941441597 2:165544567-165544589 TCTCCTCTACTCTCTCACTCTGG - Intronic
941461240 2:165774196-165774218 TCACCTCCTTTCTGTTCCTGAGG + Intronic
942558894 2:177199787-177199809 TTTTCTCTTTTCTGTGACTGTGG - Intergenic
943349080 2:186776262-186776284 TGTCCTATATTCTGTTAATGTGG - Intergenic
943542106 2:189229030-189229052 TATCCTTTATTCTGTTAATGTGG - Intergenic
945149726 2:206777441-206777463 TCTCCTTTATTTTGTTAATGTGG + Intronic
945315371 2:208365453-208365475 TGTCCTTTATTCTGTAAATGTGG + Intronic
945385699 2:209197773-209197795 CTTCCTCCATTCTGTTACCGTGG - Intergenic
945389798 2:209250555-209250577 TCTTCTTCATTCTGTTAATGTGG - Intergenic
945463684 2:210141818-210141840 TGTCCTTCATTCTGTTAATGTGG + Intronic
945579749 2:211578613-211578635 TGTCCTCTATTCTGTTCCATTGG - Intronic
946748051 2:222864845-222864867 AGGCCTGTATTCTGTTACTGTGG - Intronic
948315771 2:237027225-237027247 TCTCATCTACTCTGTGACTCCGG - Intergenic
948532829 2:238623361-238623383 GCTTCTCTATTCTGTTCCTTTGG - Intergenic
948810549 2:240473737-240473759 TATCCTTTATTCTGTTAATATGG - Intergenic
1168730766 20:78553-78575 TGTCCTTCATTCTGTTAATGTGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170486775 20:16825619-16825641 TGTTCTCTATTCTGTTACATTGG - Intergenic
1170977402 20:21178841-21178863 TATCTTTCATTCTGTTACTGTGG + Intronic
1171395757 20:24832062-24832084 TCTTCTGTATTCTGTTATGGTGG + Intergenic
1171402248 20:24881800-24881822 TCTCCTTTATTATGTTAATGTGG - Intergenic
1173465317 20:43276270-43276292 CCTCCTCCATGCTGTCACTGGGG + Intergenic
1173935681 20:46860762-46860784 TCTCCTTGATTCTGTTAATGTGG + Intergenic
1174101920 20:48133921-48133943 TCTCCTTCATTCTGTTAATGTGG + Intergenic
1174311123 20:49655468-49655490 TCGCCTCATTTCTGTAACTGAGG - Intronic
1174598669 20:51706349-51706371 TTTCCTCTATTTTGTTATAGGGG + Intronic
1175170701 20:57079147-57079169 TCCCCTTCATTCTGTTAATGTGG + Intergenic
1175536167 20:59715394-59715416 TCTAATTTATTCTGTTAATGTGG + Intronic
1176182894 20:63759908-63759930 TCTCCTTTATTCGGCTAATGTGG + Intronic
1176926532 21:14756902-14756924 TATCCTTTATTCTGTTAATGTGG - Intergenic
1177081662 21:16646744-16646766 TCTCCTTTATCCTGTTAACGTGG + Intergenic
1177308706 21:19357009-19357031 TGTCCTTTATCCTGTTAATGTGG - Intergenic
1177352123 21:19957160-19957182 TGTTCTCTATTCTGTTCCTTTGG + Intergenic
1177768274 21:25484224-25484246 TATCCTTCATTCTGTTAATGTGG - Intergenic
1178267909 21:31161378-31161400 CCTCCTCTCTCCTGTGACTGTGG - Intronic
1178473144 21:32913065-32913087 TATCATATATTATGTTACTGCGG + Intergenic
1178897845 21:36575083-36575105 TCTCCTCTATTCTCTTTTTATGG + Intronic
1179379247 21:40883236-40883258 TCTCCTCTCTTCTCTTCTTGTGG + Intergenic
1179971679 21:44839294-44839316 TTTTCTCTATGCTATTACTGTGG - Intergenic
1180243303 21:46527126-46527148 TCACCTTTATTTTGTTAATGTGG + Intronic
1180616226 22:17129735-17129757 TCTCCTTTAATCTGTTAATATGG - Intronic
1181004335 22:20003598-20003620 TGTCCTTTATTCTATTACTGTGG - Intronic
1181379080 22:22485283-22485305 CCTCCCGTATTCTGTTTCTGTGG - Exonic
1181642113 22:24207512-24207534 TCTTCTTTATTCTGTGAGTGTGG + Intergenic
1181713726 22:24708330-24708352 TCTCCTTCATTCTATTAATGTGG - Intergenic
1182156874 22:28082517-28082539 TGTCCTTCATTCTGTTAATGTGG + Intronic
1182525489 22:30915065-30915087 TCTCCTTTAATTTGTTAATGTGG - Intergenic
1182735244 22:32528681-32528703 CCTCCTCAATTCACTTACTGGGG + Intronic
1184316364 22:43694679-43694701 TCTCCATTATTCTATTACTATGG - Intronic
1184574688 22:45353555-45353577 TTTCCTCTCTTTTGTTACTCTGG + Intronic
1184613330 22:45620489-45620511 TCTCCTTTATTCTGTTATTATGG + Intergenic
1184845424 22:47081221-47081243 TCCCCTTTATTCTGTTAACGTGG - Intronic
1185209063 22:49556652-49556674 TCTCCTTTACTTTGTTACTATGG + Intronic
949125285 3:439674-439696 TCTTCTCTCTTCTGTTTCTTTGG - Intergenic
949203974 3:1415965-1415987 TCTCCACTCTTGTCTTACTGGGG - Intergenic
950508074 3:13408142-13408164 TCTTCTTTATTCTGTTAATATGG + Intronic
950699717 3:14733234-14733256 CCTCCTTTATTCTATTATTGTGG + Intronic
951021549 3:17786469-17786491 TGTCCTTCATTCTGTTAATGTGG + Intronic
951176827 3:19611660-19611682 TCTCCTCAATCCTGTTTCAGAGG + Intergenic
951229748 3:20164302-20164324 TCTCCTTTATTCTCTTAATATGG - Intronic
951261912 3:20519970-20519992 TCTCCTCTATTCTGTTCCATTGG + Intergenic
951568082 3:24032538-24032560 TGTCCTTTATTCTGTTAATGTGG + Intergenic
951606299 3:24438768-24438790 TCTCATCTACTCTCTTACCGAGG - Intronic
951776135 3:26312429-26312451 TCTTCTTTCTTCTCTTACTGCGG - Intergenic
951806436 3:26649366-26649388 TCTCCTCTATTTTGTTTCTTTGG + Intronic
952604519 3:35128768-35128790 TCTCCTTTAATCTGTTAATGTGG - Intergenic
952749405 3:36813272-36813294 TCTGCTATATTCTGTTCCTTAGG + Intergenic
953088784 3:39702602-39702624 TCTCTTTTATTCTGTTAATGTGG + Intergenic
954528134 3:51291969-51291991 TCTCCTTCATTCTGTTAATATGG - Intronic
954741581 3:52755403-52755425 TTTCCTTCATTCTGTTAATGTGG - Intronic
954910474 3:54102867-54102889 TCTCCTTTATTCTGTTAATGTGG + Intergenic
955404729 3:58618830-58618852 TTTCTTCAATTCTGTTTCTGGGG + Intronic
955661003 3:61298978-61299000 TCTCGTATATTTTGCTACTGAGG - Intergenic
956253403 3:67258486-67258508 TGTTCTATACTCTGTTACTGAGG - Intergenic
956388049 3:68742086-68742108 TATCCTTCATTCTGTTAATGTGG - Intronic
956389921 3:68760636-68760658 TTTCCTCTATTCTGCTCCCGTGG - Intronic
957258953 3:77875713-77875735 TTTCCTCCATTCTGTTCTTGTGG - Intergenic
957505282 3:81112564-81112586 TGTCCTTCATTCTGTTAATGTGG - Intergenic
957884543 3:86269020-86269042 TCATCTCTATTCTGCTACTGAGG + Intergenic
958743637 3:98107110-98107132 TGTCCTTCATTCTGTTAGTGTGG + Intergenic
959694614 3:109235413-109235435 TCTCCTCTAATGTTTTATTGAGG - Intergenic
959734533 3:109642887-109642909 TCTCCTCTCTCCAGTTCCTGAGG - Intergenic
960514060 3:118583423-118583445 TTTCCTTTATTCTGTTTATGTGG - Intergenic
960598121 3:119425852-119425874 TGTCCTTCATTCTGTTAATGTGG + Intergenic
960633754 3:119761709-119761731 TGTCCTTTATTCTGTTAATATGG - Intronic
960704317 3:120467527-120467549 TCTCCTGTCTTCTGTGACAGAGG - Intergenic
962476014 3:135756115-135756137 TCTCTTCTATTGTTTTACTATGG - Intergenic
962555789 3:136549942-136549964 TATCCTTCATTCTGTTAATGTGG + Intronic
962866243 3:139449965-139449987 GCTCCTCTAATCTGGTTCTGAGG - Intergenic
963457332 3:145560883-145560905 TATCCTTTACTCTGTTAATGTGG + Intergenic
964191515 3:154007601-154007623 TCCCTTTTATTCTGTTAATGTGG - Intergenic
964267034 3:154910293-154910315 TGTTCTCTATTCTGTTCCTTTGG - Intergenic
964514045 3:157487780-157487802 TCCCCTTTAATCTGTTAATGTGG - Intronic
964541774 3:157787435-157787457 TCTGCTCTATACTGCTGCTGGGG - Intergenic
965099295 3:164276497-164276519 TATTCTTTATTCTGTTAATGTGG - Intergenic
965135754 3:164765149-164765171 TATCCTTTATTCTGTTAAAGGGG + Intergenic
965562320 3:170073545-170073567 TCTCCTTTATTCTGTTAATGTGG + Intronic
965724744 3:171703074-171703096 TCTCCTTTTTGTTGTTACTGTGG - Intronic
966518032 3:180841377-180841399 TATCCTTCATTCTGTTAATGAGG + Intronic
967635935 3:191802929-191802951 TGTTCTTTATTCTGTTAATGTGG - Intergenic
968109637 3:196034046-196034068 TCTCCTTTATTCTGTCAATATGG + Intronic
968173749 3:196530764-196530786 TATCCTCTATTCTGTTCCATTGG + Intergenic
968482352 4:839962-839984 TCTCCTTTATTCGGTTAATGTGG + Intergenic
968532789 4:1103615-1103637 TCTCATTTATTTTGTTAATGTGG - Intronic
969223315 4:5776154-5776176 TCTCCTTTATTCTGTTAATTTGG + Intronic
970012397 4:11473517-11473539 TCTCCTCTCTGCTTTCACTGAGG + Intergenic
970352679 4:15218977-15218999 TCTCATTTAGTCTGTTAATGTGG - Intergenic
971088492 4:23309956-23309978 TCTCCTCTATTCTCTTCATCTGG + Intergenic
971615214 4:28780599-28780621 TCTCCTCTCTTCTATTTCTCTGG + Intergenic
971853878 4:32019069-32019091 TCTCTTATCTTCTTTTACTGAGG + Intergenic
971971434 4:33625845-33625867 TCTCATCTATTCTGTGCCTGAGG + Intergenic
972005356 4:34096521-34096543 TATCCTTTATTCTGTTAATATGG - Intergenic
972043290 4:34631706-34631728 GTTTCTCTATTCTGTTACTTTGG - Intergenic
973676669 4:53270236-53270258 TCTCCCTTAATCTGTTAATGTGG - Intronic
974017801 4:56664807-56664829 TCTCCTCTCATCTATTAATGAGG + Intronic
974205269 4:58694816-58694838 TGTTCTCTATTCTGTTTCAGTGG - Intergenic
974442104 4:61932443-61932465 TATCCTTTATTCTGTTAATGTGG + Intronic
975185839 4:71401484-71401506 TCTCTTCTATTTTGTTGCTATGG + Intronic
976579729 4:86721762-86721784 TCTCCTCTCTTCTGTCACCCAGG + Intronic
976697506 4:87933740-87933762 TATCCTTTCTTCTGTTAATGTGG + Intergenic
976769147 4:88632637-88632659 TCACCTCTGTTCTGCTACTGAGG - Intronic
976994737 4:91416513-91416535 TTTTCTCTATTCTGTTACATTGG - Intronic
977109241 4:92931223-92931245 TCTCCTTTATTCTATTAATATGG - Intronic
977444835 4:97117694-97117716 TGTCCTCTATTCTGTTCCATTGG + Intergenic
977674457 4:99732487-99732509 TCTCATCTTTTCTATTACTTAGG - Intergenic
977902079 4:102434098-102434120 TATCCTTCATTCTGTTAATGTGG - Intergenic
978135376 4:105251501-105251523 TCTCCTTTATTCTATTAATATGG + Intronic
978446433 4:108785076-108785098 TGTCCTCTATTCTGTTCCACTGG - Intergenic
978625112 4:110676629-110676651 TCTCCTCTCTCCTGTTTCTATGG + Intergenic
978816860 4:112916357-112916379 TCTCCTATTTTCTATCACTGAGG - Intronic
979949247 4:126872244-126872266 TCTCTTTTAATCTGTTACTGTGG - Intergenic
979950333 4:126885189-126885211 TCTTGTCTAGTCTGTTGCTGTGG + Intergenic
980023881 4:127741485-127741507 TGTCCTTCATTCTGTTAATGCGG + Intronic
980210818 4:129784976-129784998 TCTTCTCTTTTCTGTCCCTGAGG + Intergenic
980245876 4:130242061-130242083 TATCCTATATTCTGTTAATATGG - Intergenic
980771866 4:137383947-137383969 TGTCCTTTATTCTGTTAATGTGG + Intergenic
980810569 4:137873343-137873365 TATCCTTCATTCTGTTAATGTGG + Intergenic
981129824 4:141146123-141146145 TCTGCTACATTCTGTTACTTTGG + Intronic
981200951 4:141978963-141978985 TCTTGTCTTTTCTGTTACTCAGG + Intergenic
981907475 4:149938570-149938592 TATCCTTCATTCTGTTACTGTGG - Intergenic
982063874 4:151633676-151633698 TGTCCTTCATTCTGTTAATGTGG - Intronic
982136980 4:152281412-152281434 TTTCTTCTATTCTGCTCCTGTGG - Intergenic
982304252 4:153913211-153913233 TCTCCTTTATTTTGTTAATATGG - Intergenic
982556343 4:156870492-156870514 TTTCCTTTATTCTGTTTCTATGG + Intronic
983917294 4:173306621-173306643 TGTCCTTCATTCTGTTAATGTGG + Intronic
984266269 4:177500756-177500778 TGTTCTCTATTCTGTTACATTGG + Intergenic
984326493 4:178260364-178260386 TTTTCTTTATTCTGTTAATGTGG + Intergenic
984425318 4:179577264-179577286 TATCCTTCATTCTGTTAATGTGG - Intergenic
984998187 4:185457125-185457147 TCTCCTTTAATCTGTTAATATGG - Intronic
985224218 4:187742473-187742495 TATCTTTTATTCTGTTAATGTGG - Intergenic
985226472 4:187766365-187766387 TGTCATCTATTCTGTTTCTCTGG - Intergenic
985326045 4:188771529-188771551 GCTTCTCTATTCTGTTCCTTTGG + Intergenic
985479488 5:99991-100013 TTTCCTTTGTTCTGTTAATGTGG + Intergenic
985986803 5:3522822-3522844 TCCCCTGTATTTTCTTACTGTGG - Intergenic
986595159 5:9413700-9413722 TCTTCCCTATCCTGTAACTGTGG - Intronic
986859948 5:11915373-11915395 TCTCCTTTATTCTGTTAATGTGG - Intergenic
987168623 5:15228258-15228280 TTCCCTTTATTCTGTTAATGTGG + Intergenic
987416480 5:17667636-17667658 TGGCCTCTATTCTGTTCCAGTGG + Intergenic
988649664 5:33134092-33134114 TGTCCTTCATTCTGTTAATGTGG + Intergenic
988711219 5:33777402-33777424 TGTCCTTCATTCTGTTAGTGTGG - Intronic
989111508 5:37911063-37911085 TGTTCTCTATTCTGTTTCTTTGG - Intergenic
989783405 5:45297828-45297850 TCTTCTCTAGTCTGTCAATGTGG - Intronic
990229106 5:53691252-53691274 TGTCCTTCATTCTGTTACTGTGG - Intergenic
991496465 5:67231111-67231133 TCTCCTTTGTTCTGTTAATGTGG + Intergenic
991987078 5:72299941-72299963 TGTCCTCCATTCTGTTACAAAGG + Intronic
992670165 5:79052078-79052100 TGTCCTTTATTCTATTAATGTGG + Intronic
993129350 5:83875754-83875776 TCTCCTCTGTACTGACACTGTGG + Intergenic
993375231 5:87142625-87142647 CCACCTCTACTCTGTAACTGAGG + Intergenic
993454449 5:88111372-88111394 TCTCTTCAATTCTGTTTCTAAGG - Intergenic
993931285 5:93944572-93944594 TCTCCTCTTTTCTTTTCATGAGG - Intronic
994061186 5:95478747-95478769 TTTTCTTTATTCTGTTAATGTGG - Intronic
994612572 5:102062956-102062978 TATCCTCCATCCTGTTAATGTGG + Intergenic
994646316 5:102473345-102473367 TTTTCTCTATTATGTTAATGTGG - Intronic
994922239 5:106061910-106061932 TCTCCTATATTCTACTAATGTGG + Intergenic
995536033 5:113137460-113137482 TTTCCTTGATTCTGTTAATGTGG + Intronic
995667330 5:114557198-114557220 TCTCCTTTATTCTGTTAATGAGG - Intergenic
996028001 5:118671612-118671634 TCTCCTTCTTTCTGTTATTGTGG + Intergenic
996137167 5:119857290-119857312 TGTCCTCGATTCTGTTAATGTGG + Intergenic
996206063 5:120737401-120737423 TGTCCTTTATTCTGTTAATGTGG + Intergenic
996463061 5:123769544-123769566 TCTCATGTATTCTGTTACTTGGG + Intergenic
996626542 5:125576629-125576651 TCTCCCATATTCTGTTTTTGGGG + Intergenic
996759910 5:126976656-126976678 TCTCCTATCTCCTGTTTCTGAGG + Intronic
997167815 5:131680545-131680567 TATCCTCTCTTCAGTTTCTGAGG + Intronic
997274204 5:132570015-132570037 TCTTTTTTATTCTGTTAATGTGG - Intronic
997274380 5:132572103-132572125 TCTTCTTTATTCTATTACTGTGG - Intronic
997620673 5:135290673-135290695 TATCCTTTATTCTGTTAATGTGG + Intronic
998893775 5:146775363-146775385 TTTCCTTTATTCTATTAATGTGG - Intronic
998968013 5:147561666-147561688 TCTCCCCTACTCTATTGCTGTGG - Intergenic
999006751 5:147989023-147989045 TATCTTTTATTCTGTTAATGTGG + Intergenic
999022782 5:148187510-148187532 TGTACTCTTCTCTGTTACTGTGG + Intergenic
999800699 5:155031177-155031199 TATCCTTTATTCTGTTAACGTGG + Intergenic
999966117 5:156811266-156811288 TGGCCTCTATTCTGTTACATTGG - Intergenic
1000257382 5:159552869-159552891 CCTCCTCTTTTCTGGGACTGTGG - Intergenic
1000723663 5:164740559-164740581 TTTGTTCTATTCTGTTACTCTGG - Intergenic
1001357053 5:171037750-171037772 GCTCCTCTATTCTGTTCCATTGG + Intronic
1001660455 5:173387920-173387942 TCTCCTCTCTTCTGTGACAAAGG + Intergenic
1001767658 5:174264428-174264450 TATCCTTTGTTCTGTTAATGTGG - Intergenic
1002016494 5:176327852-176327874 TCTTCTTTATTCTGTTGATGTGG + Intronic
1002084044 5:176759330-176759352 TAGCCTTTATTCTGTTAGTGTGG - Intergenic
1002403468 5:179008611-179008633 TTTCCTTTAATCTGTTAATGCGG - Intergenic
1002438141 5:179245925-179245947 AGTCCTCTATTCTGTCACTTTGG - Intronic
1002735111 5:181380076-181380098 TATCCTTCATTCTGTTAATGTGG + Intergenic
1002749415 6:94048-94070 TATCCTTCATTCTGTTAATGTGG - Intergenic
1003723952 6:8737612-8737634 TTTCCTCCATTCTATTAATGTGG - Intergenic
1004072852 6:12317689-12317711 TCTCCTTTATTCTCTTAATGTGG + Intergenic
1005037977 6:21574732-21574754 TCTCCCGTATTCTGTTAATGTGG + Intergenic
1005153305 6:22776978-22777000 TCTCCTCTACTCTGCAACTGAGG - Intergenic
1005366214 6:25080258-25080280 TCTCCTTTATTCAGTTAATGTGG + Intergenic
1005379046 6:25215433-25215455 TATTCTCTAGTCTGTTTCTGTGG - Intergenic
1005900278 6:30211391-30211413 TCTTTTCTATTCTGATCCTGGGG + Intronic
1006241585 6:32684595-32684617 TTTCCTCTAATTTGTTCCTGAGG - Intergenic
1006768846 6:36534177-36534199 TCTCCTTTATTCTTTTAATATGG - Intronic
1006955594 6:37868202-37868224 TCTTCTTTATTCTGTTAATGGGG + Intronic
1006958180 6:37896322-37896344 TCTCCTTTATTTTGTTAATGTGG + Intronic
1007193997 6:40043965-40043987 CCTCCTTCATTCTGTTAATGTGG - Intergenic
1007815201 6:44517963-44517985 TGTTCTCTATTCTGTTCCTTTGG + Intergenic
1008238619 6:49080157-49080179 TGTCCTTCATTCTGTTAATGTGG + Intergenic
1008716169 6:54292688-54292710 TGTTCTTTATTCTGTTAATGTGG + Intergenic
1009514420 6:64596524-64596546 TCTTCTCTATTCTGTTCCATTGG - Intronic
1011574308 6:88778058-88778080 TAGCTTTTATTCTGTTACTGTGG + Intronic
1011759724 6:90549172-90549194 TCTGCTTTCTTCTGTTACTCTGG - Intronic
1011951387 6:92969570-92969592 TCTTCTTTATTCTATTAATGTGG + Intergenic
1012077929 6:94717060-94717082 TGTCCTTCATTCTGTTAATGTGG - Intergenic
1012150092 6:95738789-95738811 TTTCCTTCATTCTGTTAATGAGG - Intergenic
1012187839 6:96243393-96243415 TTTCCTCTAATCTGTTAATATGG - Intergenic
1012293322 6:97486719-97486741 TGTCCTTCATTCTGTTAATGTGG + Intergenic
1012350803 6:98248066-98248088 TCTTCCCTGTTCTGTTACTGTGG - Intergenic
1012463092 6:99485854-99485876 TCTTCTTTATTCTGTTAATGTGG - Intronic
1013326626 6:109051684-109051706 TCTCAGGTATTCTGTTACAGTGG - Intronic
1013949390 6:115761188-115761210 TATCTTTTATTCTGTTAATGTGG - Intergenic
1014278072 6:119409502-119409524 TCTTTTCTAATCTGTTAATGTGG - Intergenic
1014566177 6:122951300-122951322 TCTCCTTCTTTCTGTTAATGTGG - Intergenic
1015076140 6:129159870-129159892 TCTCCTTTATTCTGTTAACGGGG + Intronic
1016064745 6:139668936-139668958 TGTCTTTTATTCTGTTAATGTGG - Intergenic
1017551505 6:155514064-155514086 TCTTCTTTAATCTGTTACTGTGG + Intergenic
1017749395 6:157476777-157476799 TGTCCTTTATTCTGTTAATGTGG - Intronic
1017937915 6:159023431-159023453 TCTCCTTTATTCTGTTAATATGG - Intergenic
1018665345 6:166131325-166131347 TCTCTTTTATTCTGTTAATGTGG - Intergenic
1019239370 6:170652391-170652413 TATCCTTCATTCTGTTAATGTGG + Intergenic
1020332546 7:7034521-7034543 TGTCCTTTATTCTGTGAATGTGG + Intergenic
1020349575 7:7203466-7203488 CCTCCTTAATTCTGTTAATGAGG + Intronic
1020953580 7:14710767-14710789 TCTTCTTTATTCTCTTAATGTGG + Intronic
1021230250 7:18078400-18078422 TGTCCTTCATTCTGTTAATGTGG + Intergenic
1021581477 7:22158513-22158535 TCTCCTCTATTTGTGTACTGGGG + Intronic
1022009114 7:26293080-26293102 TCACCTCCATTCTCTCACTGAGG - Intronic
1022039936 7:26571448-26571470 TCTCCTTTAATCTCTTAATGTGG - Intergenic
1022070323 7:26907414-26907436 TCTTCTTTATTCTAGTACTGAGG - Intronic
1022523343 7:31021875-31021897 TCTCCTCTTTTCTGTGAATAAGG - Intergenic
1022705435 7:32797913-32797935 TGTCCTTTATTCTGTTAGTATGG - Intergenic
1023235108 7:38077640-38077662 TGTCTTTTATTCTGTTAATGTGG - Intergenic
1023696022 7:42847516-42847538 TATCCTTTATTCTGTTAATGTGG - Intergenic
1024039385 7:45539122-45539144 TCTCTTGTGTTCTGTTAATGTGG - Intergenic
1024162008 7:46685923-46685945 TATCCTTCATTCTGTTAATGTGG - Intronic
1024440524 7:49411227-49411249 TCTCCTTTATTTTCTTAATGTGG - Intergenic
1025015943 7:55439226-55439248 TCTCCTCTTCTCTGCTGCTGTGG - Intronic
1025637108 7:63331804-63331826 TGTCCTCTATTCTATTAATATGG - Intergenic
1025645587 7:63416298-63416320 TGTCCTCTATTCTATTAATATGG + Intergenic
1025741764 7:64203470-64203492 TCTTATCTTTTCTGTTACTCTGG - Intronic
1025968408 7:66297656-66297678 TTTCTTCTTGTCTGTTACTGTGG - Intronic
1026782129 7:73275328-73275350 TGTCCTTTATTCTGTCAATGTGG - Intergenic
1027022890 7:74828172-74828194 TGTCCTTTATTCTGTCAATGTGG - Intronic
1027065033 7:75117139-75117161 TGTCCTTTATTCTGTCAATGTGG + Intronic
1027147864 7:75710279-75710301 TTTCCTTCATTCTGTTAATGTGG + Intronic
1028006929 7:85584295-85584317 TCTCTTTAATTCTGTTAATGAGG - Intergenic
1028767207 7:94573054-94573076 TATCCTCTATTCTGTTCCATTGG + Intergenic
1029167164 7:98600534-98600556 ACTCCTCTAGTCTTCTACTGGGG + Intergenic
1029963701 7:104715661-104715683 TATCCATTATTCTGTTATTGTGG + Intronic
1030151021 7:106405036-106405058 TCTCCTCCAATCTGTAACTCAGG + Intergenic
1030662333 7:112233959-112233981 CTTCCTCTATTCAGTTACTTAGG + Intronic
1031005198 7:116461975-116461997 TCTTCTTTATTCTGTTACTGTGG - Intronic
1031345537 7:120661346-120661368 CCTCCTTTTTTCTTTTACTGAGG - Intronic
1031472878 7:122188622-122188644 TATCCTTTATTCTGTTAATGTGG - Intergenic
1031590624 7:123587805-123587827 TATCCTCTATTCTGTTAATGTGG + Intronic
1031792381 7:126123295-126123317 TTTTCTCTATTGTGTTACTTGGG - Intergenic
1031941543 7:127794652-127794674 TTTCCCCTCTTCTGTAACTGTGG + Intronic
1032040481 7:128556175-128556197 TCTCCTTTATTCTATTAATATGG - Intergenic
1032610670 7:133408827-133408849 ACACCTGTATTCTGGTACTGTGG + Intronic
1033766358 7:144495613-144495635 TGTCCTTCATTCTGTTAATGTGG + Intronic
1035172596 7:157026987-157027009 TGTCCTTCATTCTGTTAATGTGG + Intergenic
1035309708 7:157958120-157958142 TTTCCTTCATTCTGTTAGTGGGG - Intronic
1035481003 7:159184792-159184814 TCTACTTTTTTCTGTTACTTGGG + Intergenic
1035508400 8:154217-154239 TATCCTTCATTCTGTTAATGTGG - Intergenic
1036418027 8:8568676-8568698 ACTCCTCTGTTCTGTTCATGTGG - Intergenic
1037216597 8:16461290-16461312 TCTGCTCTATTCTGTCACTCAGG - Intronic
1037369214 8:18155957-18155979 TTTGCTCTATTATGTTAATGTGG - Intergenic
1037459993 8:19099391-19099413 TCTCCCTTACTCTGTCACTGAGG + Intergenic
1038101256 8:24378618-24378640 TCTCCTTTATTCTGTCAATAAGG - Intergenic
1038161100 8:25038872-25038894 TCCCCTCTATTCTGTTTATATGG + Intergenic
1038161183 8:25039963-25039985 TCCCCTCTATTCTGTTTATATGG + Intergenic
1038719860 8:30025367-30025389 TCTCCTTTGTTCTATTAATGTGG - Intergenic
1038782795 8:30582600-30582622 TCTCCTCCATTCTCTAAGTGTGG + Intronic
1039142506 8:34407060-34407082 TCTTCTTTATTCTTTTAGTGTGG + Intergenic
1039293033 8:36119476-36119498 TAACCTTTATTCTGTTAATGTGG - Intergenic
1039295483 8:36146882-36146904 TTTTCTTTATTCTGTTAATGTGG + Intergenic
1039654365 8:39384004-39384026 TCTCCTTCATTCTATTAATGTGG + Intergenic
1039665216 8:39518307-39518329 TATCCTTTATTCTGTTAATGTGG + Intergenic
1040773340 8:51007359-51007381 TCCCCTTTGTTCTGTTAATGTGG - Intergenic
1040910980 8:52518703-52518725 TCTCCTGGTTTCTGTTTCTGTGG + Intergenic
1041126478 8:54645493-54645515 TCTCCTGTGTTCTGTTAATATGG + Intergenic
1041454978 8:58049165-58049187 TCTCATATATTATGTTTCTGGGG + Intronic
1041468641 8:58183806-58183828 TCTCCTCTATTTTTTTTTTGTGG - Intronic
1041558324 8:59184658-59184680 TGTCTCCTATTCTGTCACTGTGG + Intergenic
1041757488 8:61330368-61330390 TCTCCTCTTTTCTTTTACCTGGG - Intronic
1042286743 8:67121438-67121460 TCCCCTTTATTCTTTTAATGTGG + Intronic
1042895650 8:73664561-73664583 TCTCCTTTATTCTATTAATTGGG + Intronic
1044025368 8:87164065-87164087 TATCCTTTATTCTGTTACTGTGG + Intronic
1044091259 8:88004802-88004824 TCTCTTTTAGTCTGATACTGGGG - Intergenic
1044371584 8:91418563-91418585 ACTTCTCTATTTTCTTACTGAGG + Intergenic
1044450229 8:92327566-92327588 TATCCTTCATTCTGTTAATGTGG + Intergenic
1044678801 8:94756581-94756603 TCTCATGTTTTCTGTGACTGAGG + Intronic
1044783368 8:95767188-95767210 TATCCTTCATTCTGTTAATGTGG - Intergenic
1044917032 8:97125603-97125625 TTTCCTTTATTATGTTAATGTGG - Intronic
1045088113 8:98709664-98709686 TCTTCTCCATTCTGTTAAGGTGG - Intronic
1045119385 8:99018853-99018875 TCTCTTTTATTTTGTTAATGTGG + Intronic
1045134315 8:99197092-99197114 TGTCCTTTATTTTGTTAATGTGG + Intronic
1045412812 8:101935910-101935932 TCTCATCTGTTCTCTTACTTAGG - Intronic
1045586428 8:103542743-103542765 TGTCCTTCATTCTGTTAATGTGG - Intronic
1045994570 8:108347676-108347698 TCTCCTCTTTTCTTTTTGTGAGG - Intronic
1046622134 8:116539360-116539382 TCTCCTCTATCCTGATTCTATGG + Intergenic
1046824811 8:118676232-118676254 TCTCATCTGTTCTGTCCCTGTGG + Intergenic
1046880737 8:119305254-119305276 TGTCCTTCATTCTGTTAATGTGG - Intergenic
1047099289 8:121658441-121658463 TTTTCTGTATTCTGTTAATGTGG + Intergenic
1047137147 8:122092478-122092500 TATCCTTTATTCTGTGAATGTGG + Intergenic
1047656880 8:126987265-126987287 TGTCCTTCATTCTGTTAATGTGG + Intergenic
1048123587 8:131608213-131608235 TTTCCCCTATTCTGTTCTTGTGG - Intergenic
1048248772 8:132839663-132839685 TCTCCTCCAAACTGTTACTCTGG - Intronic
1048480564 8:134787514-134787536 TTTGCTCTAGTCTGTTACTTTGG + Intergenic
1048734301 8:137481410-137481432 TCTCCTCGTTTCTGCTACAGGGG - Intergenic
1049140238 8:140947981-140948003 TCTCCTTTATTTTGTTATTTAGG + Intronic
1049635726 8:143687931-143687953 TCTCCTTTATTCTGTTAATTTGG + Intronic
1050378732 9:5001456-5001478 GCTCCATTATTCTGTTAATGAGG + Intronic
1050435538 9:5605868-5605890 TCCCCTGTAGTCTGTTAATGCGG - Intergenic
1050657775 9:7847915-7847937 TCTCATCTTTTCTATTACTCAGG + Intronic
1051031204 9:12681503-12681525 TTTTCTCTATGCTTTTACTGTGG + Intergenic
1051245417 9:15105922-15105944 TGTCTTCCATTCTGTTATTGTGG - Intergenic
1051324762 9:15953448-15953470 TAGCCTTCATTCTGTTACTGTGG + Intronic
1051326978 9:15982607-15982629 CCTCCTCTCCTCTGTTCCTGGGG + Intronic
1051426682 9:16938879-16938901 TTTCCTTTATTCTTTTAATGTGG - Intergenic
1051699427 9:19804899-19804921 TCTCCTTTATTCTACTAATGTGG + Intergenic
1052002373 9:23300686-23300708 TCTCCTTTATTCTGTTAATGTGG + Intergenic
1052009852 9:23394464-23394486 TGTCCTTTATTCTGTTAATGTGG - Intergenic
1052243245 9:26301117-26301139 TCTCATTTACTGTGTTACTGTGG - Intergenic
1052248536 9:26368882-26368904 TTTCCTCTGTTCTATTGCTGTGG - Intergenic
1052815186 9:33097354-33097376 TCTCCCTTATTCTGTTAACGGGG - Intergenic
1053076252 9:35137293-35137315 TCTTATCTTTTCTGTTACTCAGG - Intergenic
1055140241 9:72868574-72868596 TCTCATTCATTCTGTTAATGTGG + Intergenic
1055159172 9:73104083-73104105 TTTCATATATTCTGTTTCTGGGG + Intergenic
1055505798 9:76947723-76947745 TTTTCTTTATTCTGTTACTCTGG + Intergenic
1055536792 9:77255279-77255301 TTTCCTTCATTCTGTTAATGGGG + Intronic
1056023923 9:82471922-82471944 TTTCCTTCATTCTGTTAATGTGG - Intergenic
1056304164 9:85272879-85272901 TCTCCTATATTCTTTTCCTGTGG - Intergenic
1056504310 9:87242656-87242678 TGTCCTTTATACTGTTACTATGG + Intergenic
1057127251 9:92627574-92627596 TGTCCTTTATTCTGTTAATGTGG - Intronic
1058036856 9:100261999-100262021 TTTCCTCTTTTCTGTTAATATGG + Intronic
1059016952 9:110529204-110529226 TGTTCTCTATTCTGTTACATTGG + Intronic
1059099887 9:111460188-111460210 TATTCTCTATTGTGTTAATGTGG - Intronic
1059206890 9:112475791-112475813 TCTCCTTTATTCTATTAATATGG + Intronic
1059426663 9:114225444-114225466 TGTCCTCTCTCCTGTAACTGGGG + Intronic
1060557621 9:124517148-124517170 CCACCTCAATTCTGTTGCTGAGG - Intergenic
1061148045 9:128811753-128811775 GCTCCTCTGTTCTGTTCCTTTGG - Intergenic
1062759578 9:138332682-138332704 TATCCTTCATTCTGTTAATGTGG + Intergenic
1203600025 Un_KI270748v1:3454-3476 TATCCTTCATTCTGTTAATGTGG + Intergenic
1186945922 X:14567319-14567341 TCTCCTTCATTCTATTAATGTGG - Intronic
1187633299 X:21198756-21198778 TGTCCTTTATTCTGTTAATGTGG - Intergenic
1187839178 X:23468609-23468631 TGTCCTTCATTCTGTTAATGTGG - Intergenic
1188089483 X:25945596-25945618 TGTCCTTCATTCTGTTAGTGTGG - Intergenic
1188405544 X:29804481-29804503 TTTCCTCCATTCTGTTTTTGTGG + Intronic
1188724338 X:33563066-33563088 TATTCTCTATTCTGTTCCTTTGG - Intergenic
1188783338 X:34312200-34312222 TCTCCTTTATTCTCTTATAGGGG - Intergenic
1188944035 X:36275458-36275480 TTTCCTACATTCTATTACTGTGG + Intronic
1189612607 X:42753158-42753180 TCTCCTCTCTTCTGTTAAGTAGG + Intergenic
1189659951 X:43286217-43286239 TCTCCTCCATACTGTGGCTGTGG + Intergenic
1189764249 X:44353564-44353586 TGTCCTTTATTCTGTTAATATGG - Intergenic
1189780509 X:44509708-44509730 TTTCCTTTATTCTGTTAATGAGG + Intergenic
1189851391 X:45179813-45179835 TCTCCTTTATTCTATTAATGTGG - Intronic
1190238282 X:48634325-48634347 TATCCTTCATTCTGTTAATGTGG - Intergenic
1190404871 X:50077017-50077039 ACTCATCTATTTTGTTAGTGAGG + Intronic
1190537523 X:51444633-51444655 TCTTCTTTATTCTGTTAATATGG - Intergenic
1190657965 X:52628953-52628975 TGGCCTCTCTTCTGTTACCGGGG + Intergenic
1190802966 X:53809446-53809468 TTTCCATTATTCTGTTAATGTGG - Intergenic
1191193368 X:57691181-57691203 TGTCCTTCATTCTGTTAATGTGG + Intergenic
1191664010 X:63679578-63679600 TCTCCTTTAATCTGTCAATGTGG - Intronic
1191970411 X:66808599-66808621 TAACCTTTATTCTGTTAATGTGG - Intergenic
1192065130 X:67876212-67876234 TCTCTTTTATTCTGTTAATGTGG - Intergenic
1192501772 X:71659016-71659038 TCTCCCCAAATCTGTTAATGTGG - Intergenic
1192508923 X:71710395-71710417 TCTCCCCGAATCTGTTAATGTGG - Intergenic
1192517774 X:71771158-71771180 TCTCCCCGAATCTGTTAATGTGG + Intergenic
1192528151 X:71865635-71865657 TCTCCCCTAATCTGTTAATGTGG - Intergenic
1192769709 X:74175629-74175651 TGTCCTTTATTCTGTTAATATGG - Intergenic
1192781789 X:74301535-74301557 TCTCCTCTATTCTGTTAATATGG - Intergenic
1193235681 X:79104168-79104190 TCCCCTTCATTCTGTTAATGTGG + Intergenic
1193242623 X:79189597-79189619 TTTCCTTTATTCTGTTAATGTGG + Intergenic
1193311988 X:80021378-80021400 TCCGCTCTCTTCTGTTAGTGAGG - Intronic
1193438108 X:81504246-81504268 TGTCCTTCATTCTGTTAATGTGG - Intergenic
1193516330 X:82469899-82469921 TGTCCTTTATTCTGTTAATATGG + Intergenic
1193636757 X:83960163-83960185 TCTTCTCTATTCTGTTCCATTGG - Intergenic
1193665812 X:84315148-84315170 TCTGTTCTATTCTGTTACACTGG - Intergenic
1193816406 X:86109423-86109445 TCTTCTCTATTCTGTTCCATTGG - Intergenic
1194070468 X:89318860-89318882 TGTCCTTAATTCTGTTAATGTGG + Intergenic
1194102416 X:89722664-89722686 TATCCTTTATTGTGTTAATGTGG + Intergenic
1194115918 X:89898271-89898293 TCCCCTTTATTCTGTTAATGTGG - Intergenic
1194217831 X:91152854-91152876 TCTTTTCTTTTCTGTTTCTGAGG - Intergenic
1194575260 X:95605360-95605382 TCTCTGCTGTTCAGTTACTGAGG - Intergenic
1194769885 X:97889447-97889469 TCTCCTTTATTCTGTTAATCTGG + Intergenic
1195737686 X:108030672-108030694 CCTCATCTCTTCTGTGACTGTGG + Intergenic
1195873355 X:109511005-109511027 TTTCCTTTAGTCTGTTAATGTGG - Intergenic
1195901736 X:109805390-109805412 TTTTCTCTAATCTGTTAATGTGG - Intergenic
1196062287 X:111423109-111423131 TCTTCTTTATTCTGTTAATATGG + Intergenic
1196381480 X:115095582-115095604 TGTCCTTCATTCTGTTAATGCGG - Intergenic
1196588792 X:117461172-117461194 TCTCATACATTCTGTTATTGAGG + Intergenic
1196708128 X:118734585-118734607 TCCCCTTTATTCTGTTAATGTGG + Intronic
1197599484 X:128510773-128510795 TGTCCTTCATTCTGTTAATGTGG - Intergenic
1198164496 X:134041325-134041347 TCTCATCTAATCTGTTAATGTGG - Intergenic
1198192185 X:134318460-134318482 AATCCTCTATTCTATTAATGTGG - Intergenic
1198946006 X:142014837-142014859 TCTCCTTTATTCTGTTCATCTGG + Intergenic
1198989918 X:142500580-142500602 TCTCCTTTGTTCTGTTAATGCGG - Intergenic
1199088840 X:143667175-143667197 TGTCCTCCATTCTGTTAATGTGG + Intergenic
1200113795 X:153760300-153760322 CCTCCTCTAATCTGTTAATGTGG - Intergenic
1200341082 X:155396345-155396367 TGTCCTTTATTCTATTAATGTGG - Intergenic
1200388895 X:155922488-155922510 TCTCCTTTATTCAGTTAGTATGG + Intronic
1200455002 Y:3379941-3379963 TATCCTTTATTGTGTTAATGTGG + Intergenic
1200468719 Y:3555400-3555422 TCCCCTTTATTCTGTTAATGTGG - Intergenic
1200486926 Y:3781033-3781055 TGTCCTTCATTCTGTTAATGTGG - Intergenic
1200554336 Y:4616652-4616674 TATGCTCTTTTCTGTTTCTGAGG - Intergenic
1200724709 Y:6654504-6654526 TGTCCTTAATTCTGTTAATGTGG + Intergenic
1202352135 Y:24004581-24004603 TGTCTTTTATTTTGTTACTGAGG + Intergenic
1202518644 Y:25665538-25665560 TGTCTTTTATTTTGTTACTGAGG - Intergenic