ID: 1113192490

View in Genome Browser
Species Human (GRCh38)
Location 13:107765707-107765729
Sequence CTTGCATCATTTATGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 258}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113192484_1113192490 22 Left 1113192484 13:107765662-107765684 CCCACCCATCCTTTTTATTTATA 0: 1
1: 0
2: 3
3: 66
4: 596
Right 1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG 0: 1
1: 0
2: 0
3: 18
4: 258
1113192487_1113192490 17 Left 1113192487 13:107765667-107765689 CCATCCTTTTTATTTATAATAAA 0: 1
1: 0
2: 13
3: 131
4: 1366
Right 1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG 0: 1
1: 0
2: 0
3: 18
4: 258
1113192483_1113192490 26 Left 1113192483 13:107765658-107765680 CCTGCCCACCCATCCTTTTTATT 0: 1
1: 1
2: 4
3: 64
4: 1048
Right 1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG 0: 1
1: 0
2: 0
3: 18
4: 258
1113192489_1113192490 13 Left 1113192489 13:107765671-107765693 CCTTTTTATTTATAATAAATGGA 0: 1
1: 0
2: 3
3: 64
4: 906
Right 1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG 0: 1
1: 0
2: 0
3: 18
4: 258
1113192485_1113192490 21 Left 1113192485 13:107765663-107765685 CCACCCATCCTTTTTATTTATAA 0: 1
1: 1
2: 2
3: 53
4: 686
Right 1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG 0: 1
1: 0
2: 0
3: 18
4: 258
1113192482_1113192490 27 Left 1113192482 13:107765657-107765679 CCCTGCCCACCCATCCTTTTTAT 0: 1
1: 0
2: 7
3: 94
4: 1096
Right 1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG 0: 1
1: 0
2: 0
3: 18
4: 258
1113192486_1113192490 18 Left 1113192486 13:107765666-107765688 CCCATCCTTTTTATTTATAATAA 0: 1
1: 0
2: 4
3: 101
4: 1056
Right 1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG 0: 1
1: 0
2: 0
3: 18
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113192490 Original CRISPR CTTGCATCATTTATGAAACC TGG Intronic
902032992 1:13436390-13436412 CTGGCATCGTATATGAAGCCTGG - Intergenic
902805460 1:18858799-18858821 AATGCATCATTTATGACACTGGG - Intronic
903221434 1:21871652-21871674 CTTGCCTTATTTATGAAATGGGG + Intronic
903672993 1:25047434-25047456 CTTTCATCATCTATAAAACAAGG - Intergenic
905516510 1:38565767-38565789 CATGCATCCTTTATGTAACGTGG - Intergenic
906012604 1:42543004-42543026 CTTGCATTATTTTTGTAAGCAGG - Intronic
908735872 1:67276340-67276362 CCAGCATCATTTATTAAACAGGG - Intergenic
909151863 1:72016557-72016579 CTTGCATGATTAAGGTAACCAGG + Intronic
910311159 1:85826158-85826180 CTAGCACCATTTATGAAATAGGG + Intronic
911489481 1:98545201-98545223 ATTGCATATTTTATAAAACCTGG + Intergenic
911907869 1:103592658-103592680 CTTGAAACATTTAGCAAACCTGG + Intergenic
911910305 1:103626462-103626484 CTTGAAACATTTAGCAAACCTGG + Intergenic
911917723 1:103720587-103720609 CTTGAAACATTTAGCAAACCTGG + Intronic
911946361 1:104114435-104114457 CCAGCACCATTTATGAAACAGGG - Intergenic
912098390 1:106173987-106174009 CCAGCATCATTTATGAAATAAGG + Intergenic
912284076 1:108349500-108349522 CTAGCACCATTTATTAAACAGGG + Intergenic
912448380 1:109754208-109754230 CTTTCATTATTTCTGCAACCTGG + Intronic
913519908 1:119635247-119635269 CTGGCATGATTTATAAAAGCAGG - Intronic
914389059 1:147202041-147202063 ATTCCCTCATTTATAAAACCTGG - Intronic
917042784 1:170824545-170824567 CTTGCATCATTTTTCTAACTGGG + Intergenic
918453298 1:184681833-184681855 CTTGCCTTATTCATGAAACTAGG - Intergenic
918682060 1:187368094-187368116 CTTTGATCATTTATTAAACGGGG - Intergenic
919036318 1:192313566-192313588 TCTGCATCAGTTATGAAATCCGG + Intergenic
919384712 1:196906369-196906391 CTTAGATCATTTATCAAAGCTGG - Intronic
920911495 1:210221897-210221919 CTTAAATCATTTCTGAAACAAGG + Intergenic
921163412 1:212488630-212488652 CTTGCATCATTTCTGATGCTTGG - Intergenic
921689151 1:218128012-218128034 CTTGCTTCTTTTAAAAAACCAGG - Intergenic
921787706 1:219251510-219251532 CTAGCATCATTTATTAAATAGGG + Intergenic
921873981 1:220173671-220173693 ATTTCATCATTTCTGAAATCTGG - Intronic
921963242 1:221058561-221058583 CTGGCATCATTTATTAAATATGG + Intergenic
924248329 1:242106726-242106748 CTTGCAGCATTTAGGGACCCAGG - Intronic
1063433430 10:6011235-6011257 CTTGCACCAGATATGGAACCAGG + Exonic
1064062384 10:12148946-12148968 TTTTCAGCATTTATGAAAACAGG + Intronic
1066537147 10:36404325-36404347 CCAGCATCATTTATTAAACAGGG - Intergenic
1066639644 10:37542841-37542863 CTAGCATCATTTATTAAATAGGG - Intergenic
1069129415 10:64680664-64680686 TTTTCTTCATTTATGAAACTTGG + Intergenic
1069312904 10:67061168-67061190 CTTGCTTCCTCTATGATACCTGG + Intronic
1070778267 10:79122865-79122887 CTTGCAGCATTTGGGAAAACTGG + Intronic
1074953738 10:118367148-118367170 CTTGCTTTATTTCTTAAACCAGG - Intergenic
1075237874 10:120747571-120747593 CTTGCCTCATACATGAAACGTGG + Intergenic
1076158757 10:128224804-128224826 CTAGCATCATTTATTAAATAGGG + Intergenic
1079585228 11:22117891-22117913 CTTGCATCCAATATGAATCCTGG + Intergenic
1079904848 11:26232540-26232562 CCTGCATCATTTATTAAATAGGG - Intergenic
1080192524 11:29569216-29569238 CTTCCAACATTTAAGAAAACTGG - Intergenic
1080322386 11:31027084-31027106 TTTGCATCATTTATGAAATATGG + Intronic
1080417415 11:32081737-32081759 CTTGCAGCAATTAAGAAAGCTGG + Intronic
1080704846 11:34680883-34680905 TTTTCATCATTTATAAAACAGGG - Intergenic
1081229864 11:40572617-40572639 TTTGCCTCATTTTTTAAACCAGG - Intronic
1082027370 11:47582600-47582622 CTAGCTTCATTTTTGTAACCTGG + Intronic
1082568113 11:54705376-54705398 CTTGCATCATTTTTAAAATGAGG - Intergenic
1082618101 11:55386999-55387021 CTTGCATCATTTATAGAACGAGG - Intergenic
1082748385 11:56993243-56993265 CATGTATCATGTATGAAACCCGG - Intergenic
1082905621 11:58305380-58305402 CCAGCATCATTTATTAAACAGGG + Intergenic
1083385096 11:62302323-62302345 CTTGCAACATTTAGCAAACCTGG - Intergenic
1085796741 11:79548195-79548217 CTTTGATCATTTATGAAGACTGG - Intergenic
1086925714 11:92638508-92638530 CTTTCCCCATTTATGAAATCTGG - Intronic
1087731540 11:101783862-101783884 CCTGCAACATTTATTAAACAGGG + Intronic
1087891659 11:103543434-103543456 CTTGCAACACTTATGTACCCTGG - Intergenic
1090331289 11:125934227-125934249 TTTCCATCATTTCTGAATCCTGG - Intergenic
1090574904 11:128090216-128090238 ATTAAATCATTTATAAAACCAGG + Intergenic
1090847079 11:130538728-130538750 CCAGCATCATTTATTAAACAGGG + Intergenic
1090961553 11:131561821-131561843 TTTGCCTCATCTATGAAATCAGG + Intronic
1091662790 12:2397033-2397055 CTTTCATCAGATATGAAAACAGG - Intronic
1093453687 12:19343043-19343065 CTTACATTATTTATGATACCAGG - Intronic
1093769666 12:23003793-23003815 ATTTCATCATCTGTGAAACCTGG + Intergenic
1093979164 12:25455742-25455764 CCAGCATCATTTATTGAACCAGG - Intronic
1094408712 12:30147219-30147241 CTGGGATCATTTATGGTACCAGG - Intergenic
1096297786 12:50398450-50398472 CTTGCATCTTTTATGCAGCATGG + Intronic
1098991284 12:77066758-77066780 CTTTCCTCATTTTTGATACCTGG + Intergenic
1099110680 12:78556589-78556611 CTTCCATCATTTACACAACCAGG + Intergenic
1102733848 12:115139866-115139888 GTTGCATTCTTTATGAAAACTGG + Intergenic
1104426761 12:128684295-128684317 TTTTCCTCATCTATGAAACCAGG - Intronic
1105648852 13:22350958-22350980 CCAGCATCATTTATTAAACAGGG - Intergenic
1106542504 13:30702657-30702679 CTTCCTTCCTTTAAGAAACCTGG - Intergenic
1107195845 13:37650480-37650502 CTTTCATCATTTTGGAAATCAGG - Intronic
1107599651 13:42000533-42000555 ATCCCATCATTTATGTAACCAGG - Intergenic
1108387188 13:49910339-49910361 TTTGCATTATTAATGCAACCTGG - Intergenic
1109639320 13:65167180-65167202 TTTGCATCATCTGTGAAACGGGG + Intergenic
1110210444 13:72966199-72966221 TTTGCATACTTTAAGAAACCTGG - Intronic
1110333888 13:74303761-74303783 ATTCCAGCATTTCTGAAACCAGG - Intergenic
1111227807 13:85297748-85297770 CTTTCATCATTGATTAAAGCAGG - Intergenic
1111332444 13:86777456-86777478 CTAGCATCATTTATTAAACAGGG + Intergenic
1111620895 13:90724514-90724536 CTTGTATCATTTATTAAGCCTGG + Intergenic
1113103618 13:106748775-106748797 ATTGCTTTATTTATGAAAACTGG + Intergenic
1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG + Intronic
1113715932 13:112507774-112507796 GTTGCGCTATTTATGAAACCAGG + Intronic
1113760305 13:112841918-112841940 CTTCCAGCATTTCAGAAACCAGG + Intronic
1114813745 14:25930673-25930695 AATGCATCATTTCTGAAAACTGG - Intergenic
1115144532 14:30211122-30211144 TTTTCTTCATTTATGAAAGCAGG + Intergenic
1115623023 14:35159446-35159468 CTTGTAGCATTTATTAACCCTGG + Intronic
1116363040 14:44025985-44026007 CCAGCATCATTTATTAAACAGGG - Intergenic
1116898051 14:50336322-50336344 CTTCTTACATTTATGAAACCTGG + Intronic
1120326020 14:83027414-83027436 CTTGCATCATTGACTAAAACAGG - Intergenic
1121396987 14:93634200-93634222 CTTAAATCATTTTTGAAACATGG + Intronic
1202841062 14_GL000009v2_random:121874-121896 CTTGACTCATGGATGAAACCCGG - Intergenic
1202882130 14_KI270722v1_random:70399-70421 CTTGATTCATGGATGAAACCTGG + Intergenic
1126897842 15:53278931-53278953 CTAGCACCATTTATTAAACAAGG - Intergenic
1127951477 15:63811504-63811526 CTTTCATCTTTTATGTTACCGGG - Intronic
1128161972 15:65429124-65429146 CATGCATCATTTATTAAATGAGG + Intergenic
1129682867 15:77667870-77667892 CTGGATTCATTCATGAAACCAGG + Intronic
1131034364 15:89211490-89211512 CCTGCTTCATTTTTCAAACCTGG - Intronic
1132202855 15:99966994-99967016 CTTGCACCACTCATGACACCAGG + Intergenic
1133361526 16:5177640-5177662 CCTGCCTCATTTATGAAGACTGG - Intergenic
1139019153 16:62725787-62725809 GTAGCTTCACTTATGAAACCAGG + Intergenic
1139083717 16:63559436-63559458 CTTCCAACAATTGTGAAACCTGG + Intergenic
1140446956 16:75037267-75037289 TTTGCCTCATTTATTAAACAAGG + Intronic
1145723985 17:27100389-27100411 CCAGCACCATTTATGAAACAGGG + Intergenic
1146613891 17:34335652-34335674 CCAGCATCATTTATTAAACAGGG + Intergenic
1150514475 17:65793683-65793705 AGTCCATCATTTATGAAAACTGG + Intronic
1152909162 17:82988264-82988286 CCTGCACCATTTATTAAACAGGG - Intronic
1153495141 18:5690394-5690416 CTAGCACCATTTATTAAACAGGG + Intergenic
1153735651 18:8064097-8064119 CTTCCATCATATTTGAAAGCTGG - Intronic
1158300119 18:56042571-56042593 CTTTCTTCATTTATTAAATCAGG - Intergenic
1164323985 19:24176631-24176653 CTAGCATCATTTATTAAATAGGG - Intergenic
1165652072 19:37500249-37500271 CTTGCACCACTCATGAAACTAGG + Intergenic
1166575910 19:43837476-43837498 TTTGCAGAATTTATGAAATCTGG - Intronic
1202631240 1_KI270706v1_random:1900-1922 CTTGATTCATGGATGAAACCCGG + Intergenic
1202657741 1_KI270708v1_random:39497-39519 CTTGATTCATGGATGAAACCTGG + Intergenic
928794851 2:35005791-35005813 CTAGCACCATTTATTAAACATGG - Intergenic
929272142 2:39984338-39984360 CCAGCACCATTTATGAAACAGGG + Intergenic
929297365 2:40263610-40263632 CTAGCACCATTTATGAAACAGGG - Intronic
931208550 2:60170723-60170745 CTTGCATAATTTTTAAACCCAGG + Intergenic
933324657 2:80820037-80820059 CTGGCATCATTTATTAAATATGG - Intergenic
935528200 2:104198781-104198803 CTTTCACCATTTATGAAATGAGG - Intergenic
937367151 2:121271717-121271739 GTTTCCTCATTTATGAAACCAGG - Intronic
937798817 2:126057784-126057806 TTTCCTTCATTTATGAAACTTGG + Intergenic
940404993 2:153291239-153291261 TTTGCATCATTTTAGAAAACAGG + Intergenic
941622909 2:167798518-167798540 CCTGCACCATTTATGAAATAGGG + Intergenic
942010388 2:171756463-171756485 CCAGCACCATTTATGAAACAGGG + Intergenic
942201894 2:173579505-173579527 GTTGCATTATTCATGAAACTGGG - Intergenic
943731410 2:191306871-191306893 CTAACATCATTTCTGATACCAGG + Intronic
945672055 2:212814075-212814097 CTTGCATCAGAGATGAAGCCTGG - Intergenic
946554925 2:220845675-220845697 ATTGCATCATATTTGAAAACTGG - Intergenic
946954539 2:224914667-224914689 CTTTCATCCTTTATGAAAGATGG - Intronic
947478496 2:230474151-230474173 ATTTCCTCATTTATGAAACAGGG - Intronic
1169013261 20:2269361-2269383 CCAGCATCATTTATTAAACAGGG - Intergenic
1169975637 20:11324153-11324175 CTTGCTTCATTTATTATACTAGG + Intergenic
1170452068 20:16493274-16493296 CTTGCACCATTTAGGCAACTTGG - Intronic
1170573023 20:17642985-17643007 CTGGCATCATTCAGGACACCTGG - Exonic
1171539651 20:25937319-25937341 CTTGTATTAGTTATGAAGCCAGG - Intergenic
1171801396 20:29622952-29622974 CTTGTATTAGTTATGAAGCCAGG + Intergenic
1172503872 20:35446666-35446688 ATTTCCTCATTTATGAAACAAGG - Intronic
1173954302 20:47018766-47018788 CTTTCACCATCTATGAAAGCAGG - Intronic
1176643463 21:9327840-9327862 CTTGATTCATGGATGAAACCTGG + Intergenic
1178187633 21:30241754-30241776 CTTTCTTCATTTATGAAAGTAGG - Intergenic
1180369472 22:11971376-11971398 CTTGATTCATGGATGAAACCCGG - Intergenic
1180376761 22:12100734-12100756 CTTGATTCATGGATGAAACCCGG + Intergenic
1181577710 22:23805933-23805955 CTTGCATCCTTTCTGGAACAGGG - Intronic
1182459291 22:30472558-30472580 CTTGCTTCATTTATAAAATGGGG + Intergenic
1183656753 22:39190255-39190277 CTTGGAGCAATTATGAAAGCGGG + Intergenic
1183754476 22:39747342-39747364 CTTGCCTCATATTTGAAACGGGG - Intronic
1185311586 22:50158706-50158728 CATGCTTCATGAATGAAACCTGG - Intronic
949095050 3:75936-75958 CTTGCATCATTTGTGAAGGTGGG - Intergenic
949180083 3:1118419-1118441 TTTTCTTCATTTATGAAACCAGG - Intronic
949308265 3:2667825-2667847 CTAGCACCATTTATTAAACAGGG + Intronic
953563827 3:44014370-44014392 CTTAAATCATTAATGAACCCAGG - Intergenic
953777153 3:45829659-45829681 CTTTCCTCATTTTTGAAATCTGG + Intronic
954173032 3:48820652-48820674 CTTTCCTCATCTATAAAACCAGG + Intronic
956615415 3:71166324-71166346 CATGAATCATTAATGACACCTGG + Intronic
957007613 3:74968586-74968608 GTTGGATCATTTATCAAACAGGG + Intergenic
957096573 3:75782378-75782400 CTTGATTCATGGATGAAACCTGG - Intronic
957647942 3:82958387-82958409 CTTGCAGTATTTATTTAACCAGG + Intergenic
957969359 3:87363300-87363322 CTTGCATCCTTGTTTAAACCTGG + Intergenic
958502206 3:94926606-94926628 CTTGCTTCATTAATCAAACTTGG + Intergenic
959766823 3:110040976-110040998 CCTGCACCATTTATTAAACAGGG + Intergenic
960559359 3:119066097-119066119 CTTGCATTAGTTATGAAAAGGGG - Intronic
963278537 3:143357740-143357762 GTTGCCTCATTTATAAAACTGGG + Intronic
963455595 3:145542527-145542549 CTAGCATCATTTATTAAATGGGG + Intergenic
964017654 3:151966487-151966509 TTTCCTTCATTTATGAAGCCTGG - Intergenic
964690053 3:159440135-159440157 CCTGCACCATTTATTAAACAGGG + Intronic
966819809 3:183915504-183915526 CTTTCTTCATCTACGAAACCTGG - Intergenic
967636220 3:191805421-191805443 TCTGCAGCATTTCTGAAACCTGG - Intergenic
1202743419 3_GL000221v1_random:77189-77211 CTTGATTCATGGATGAAACCTGG - Intergenic
969169228 4:5346520-5346542 CCTGCATCAATTATGCAATCTGG - Intronic
971400980 4:26275109-26275131 GTTGCTTCATTTATGAAATAGGG - Intronic
971493997 4:27244785-27244807 ATTTCATGATTTATGAACCCTGG - Intergenic
971579251 4:28313185-28313207 CTTGCATCAATAAGGGAACCAGG - Intergenic
972106692 4:35496483-35496505 CCAGCATCATTTATTAAACAAGG - Intergenic
972506885 4:39728173-39728195 CTTGAATCAGTTTTAAAACCTGG + Intronic
974275534 4:59716119-59716141 GTTACAACATGTATGAAACCAGG - Intergenic
974446018 4:61982816-61982838 CTTAAATCATTTTTGAAACAAGG + Intronic
976892923 4:90072574-90072596 CTTGCATGTTTTGAGAAACCAGG + Intergenic
977027511 4:91837975-91837997 CTTGCCTCACTTAGCAAACCAGG - Intergenic
977321700 4:95524358-95524380 CTTGCATGTTTTATGCAACAGGG + Intronic
977646755 4:99421408-99421430 CTAGCATCATTTATTAAATAGGG - Intronic
980652648 4:135739552-135739574 CTTCAATCATTTATTAATCCAGG + Intergenic
980803252 4:137780390-137780412 CCAGCATCATTTATTAAACAGGG + Intergenic
981136778 4:141219973-141219995 CTTTCATCAGTAATGAAACTGGG + Intergenic
984625330 4:182000715-182000737 CTTGCTTCATCTAAGAAAACAGG + Intergenic
984854414 4:184181767-184181789 CCAGCACCATTTATTAAACCAGG - Intronic
985314497 4:188641870-188641892 CATGAATCATTTAAGAAACTTGG - Intergenic
985989056 5:3540039-3540061 CTGGCATCCTTTAGGCAACCTGG - Intergenic
987880281 5:23735224-23735246 CTAGCACCATTTATTAAACAGGG - Intergenic
988247600 5:28707321-28707343 CTTTTATCATTTTTGAAACCTGG + Intergenic
990839565 5:60061823-60061845 CCAGCATCATTTATTAAACAGGG - Intronic
991338030 5:65572685-65572707 CTGGCACCATTTATGAAGACAGG - Intronic
991433671 5:66573829-66573851 CTTCCTTCATTTATGCAACTGGG + Intergenic
992047757 5:72913035-72913057 CTTGGAACATTTAAGAAAACTGG + Exonic
992896748 5:81252516-81252538 CTTGCTTATTTTTTGAAACCTGG + Intronic
993474735 5:88350579-88350601 CTAGCACCATTTATTAAACAGGG - Intergenic
994009237 5:94880677-94880699 CTTGCATCATCTCTGCAACCAGG + Intronic
994174688 5:96698642-96698664 CATGCATCATTTAGAAAAGCTGG + Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996537394 5:124592859-124592881 CTTGCTTCATTCAAGAAGCCTGG + Intergenic
997741259 5:136256965-136256987 CCAGCATCATCTATGACACCAGG - Intronic
1000639230 5:163681825-163681847 CTTTCATCTTTTAAGCAACCAGG - Intergenic
1000870545 5:166571884-166571906 CTGGCAACATTTATGTAACTTGG + Intergenic
1001792498 5:174470801-174470823 CTGGCACCATTTATTAAACAGGG - Intergenic
1002369069 5:178735790-178735812 CCTGCACCATTTATAAAACACGG + Intergenic
1003346887 6:5277908-5277930 CTTCCCTCATTTATGAAGTCAGG - Intronic
1003674598 6:8191661-8191683 CTTGAATCATTTATTTAAGCGGG + Intergenic
1004435934 6:15594125-15594147 CTTGCATAGTTTATGAACCATGG - Intronic
1005207765 6:23424236-23424258 CTGGCATCATTTATCAAATAGGG - Intergenic
1006076602 6:31536930-31536952 CTTCCTTCATTTATGAGGCCAGG + Intronic
1007016997 6:38478869-38478891 CTTTTATCATATATAAAACCAGG + Intronic
1011078681 6:83465899-83465921 CTTTCATCATCTATGAAATGTGG + Intergenic
1011881108 6:92027917-92027939 CTGGCATGCTTTAAGAAACCTGG + Intergenic
1012432506 6:99179673-99179695 CTTGCTTCATTTTTGACACCAGG + Intergenic
1013147742 6:107411355-107411377 ATGACATCATTTATGAAAACTGG + Intronic
1015636134 6:135276360-135276382 CCAGCACCATTTATGAAACAGGG - Intergenic
1017475251 6:154784449-154784471 CTTGCTTTATTTAAGAAACCAGG + Intronic
1017950217 6:159129788-159129810 CTTGGAGCATTTATGGGACCTGG + Intergenic
1019634197 7:2066914-2066936 CTGGCCTCACTTAAGAAACCAGG + Intronic
1020600032 7:10262991-10263013 ATTGCAGCATCTATGAGACCAGG - Intergenic
1020974441 7:14987825-14987847 CTTGCATCATTTAAGCAACTGGG + Intergenic
1021389348 7:20072693-20072715 CCAGCATCATTTATTAAACAGGG - Intergenic
1024366485 7:48526363-48526385 CTTGGACCATTTAAGATACCTGG - Intronic
1024691795 7:51810538-51810560 CTTGCATAATTGCTGAAACTAGG - Intergenic
1025291036 7:57723250-57723272 CTTGTATTAGTTATGAAGCCAGG - Intergenic
1025789369 7:64673804-64673826 CTAGCATCATTTATTAAATACGG + Intronic
1026221184 7:68398945-68398967 CTTGCTTGATTTAGGAAACTTGG + Intergenic
1026676478 7:72432694-72432716 CTTGCATCCTTTCTGGAACAAGG + Intronic
1032662267 7:133997831-133997853 CTGGCATGATCTATGAAATCAGG + Intronic
1032791210 7:135243939-135243961 CTTTCAGCATTTGTGACACCTGG - Intronic
1033638216 7:143233214-143233236 CCAGCATCATTTATCAAACAGGG + Intergenic
1033651155 7:143345049-143345071 ATTTCATCATTTAAAAAACCTGG - Intronic
1035843362 8:2836315-2836337 ATTTCTTCAATTATGAAACCAGG + Intergenic
1036136830 8:6169759-6169781 CTTGCATCCTTTATTCAACAGGG - Intergenic
1036592019 8:10176979-10177001 CCTGCTTCATTTATGAAACTGGG - Intronic
1039738772 8:40360551-40360573 GTTATCTCATTTATGAAACCAGG - Intergenic
1041485265 8:58369709-58369731 ATTGCATCATGTATGACAACAGG - Intergenic
1041598305 8:59683553-59683575 CCTGCATCATTTATTAAATAGGG - Intergenic
1042337311 8:67641779-67641801 ATTGTATCATCTATGAAAACTGG - Intronic
1042348938 8:67756633-67756655 CCAGCATCATTTATTAAACAGGG - Intergenic
1044230860 8:89776174-89776196 CTTACCTCATTTATTAAACTTGG - Intronic
1044469113 8:92545340-92545362 CTGGAATCATCAATGAAACCTGG - Intergenic
1046834129 8:118780422-118780444 TTTGCTTCAGTTATGCAACCAGG + Intergenic
1048145706 8:131840831-131840853 TTTGTGTCATTTCTGAAACCTGG + Intergenic
1048458171 8:134597295-134597317 ATAGCATGATTTATGAAAACAGG - Intronic
1050376107 9:4975030-4975052 CTTACATCATTTCTAAAAACTGG - Intergenic
1051766297 9:20527919-20527941 CTTTCCTCATTTCTGAAATCAGG - Intronic
1051830834 9:21274315-21274337 CTAGCACCATTTATTAAACAGGG - Intergenic
1051869462 9:21720142-21720164 CTTGCCTCATTTGTGAAATGAGG + Intergenic
1052152726 9:25139025-25139047 CTTGCTTCATTTATGGAAGGAGG - Intergenic
1052430357 9:28358656-28358678 GTTTCCTCATTTATGAAACGGGG + Intronic
1054165411 9:61722122-61722144 CTTGTATCAGTTATGAAGCCAGG + Intergenic
1055489465 9:76789905-76789927 CTTGCATCATTCTTAGAACCAGG - Intronic
1055796287 9:79977990-79978012 CTAGCTTCATTAATCAAACCAGG - Intergenic
1059218823 9:112592479-112592501 GTTTCATCATTTATAAAACAAGG + Intronic
1203689968 Un_GL000214v1:33177-33199 CTTGATTCATGGATGAAACCTGG + Intergenic
1203712054 Un_KI270742v1:107153-107175 CTTGATTCATGGATGAAACCTGG - Intergenic
1203539151 Un_KI270743v1:71039-71061 CTTGATTCATGGATGAAACCCGG + Intergenic
1203646307 Un_KI270751v1:70876-70898 CTTGATTCATGGATGAAACCTGG - Intergenic
1186672060 X:11777798-11777820 TTTTCATCAGTTATGAAATCTGG + Intergenic
1187371845 X:18715690-18715712 CTTTCCTCATTTATAAAACGAGG - Intronic
1189071973 X:37873541-37873563 TTTGAATCATTTATGAGACAGGG + Intronic
1189107252 X:38249732-38249754 TTATCATCATTTATAAAACCAGG - Intronic
1189118654 X:38370036-38370058 CTTGCAGCTTTTATGAGAACTGG - Intronic
1189119883 X:38383335-38383357 CTTTCCTCATCTATAAAACCAGG - Intronic
1191079182 X:56490706-56490728 CTGGCATCATTTATGAAATAGGG + Intergenic
1198087189 X:133292768-133292790 CTAGCTGCATTTATGAGACCTGG - Intergenic
1198244986 X:134821789-134821811 CTTAAATCATTTCTGAAACTAGG + Intronic
1198981807 X:142406267-142406289 CTAGCATCATTTATTAAATAGGG - Intergenic
1199172866 X:144752069-144752091 CCAGCATCATTTATTAAACAGGG + Intergenic
1201166285 Y:11212096-11212118 CTTGACTCATGGATGAAACCTGG - Intergenic
1201391773 Y:13505097-13505119 TCTGCTTCATTTATGAAACTTGG - Intergenic
1201566909 Y:15374795-15374817 CTTGTGTCATTTCTGAACCCAGG - Intergenic