ID: 1113195115

View in Genome Browser
Species Human (GRCh38)
Location 13:107794364-107794386
Sequence CTGAGCAATTCTAATAGTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113195115_1113195122 29 Left 1113195115 13:107794364-107794386 CCGGTACTATTAGAATTGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1113195122 13:107794416-107794438 ATGAGAATGTTAATGATGACAGG 0: 1
1: 0
2: 0
3: 26
4: 267
1113195115_1113195118 -3 Left 1113195115 13:107794364-107794386 CCGGTACTATTAGAATTGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1113195118 13:107794384-107794406 CAGCCCTTGAACTGGAAAGAGGG 0: 1
1: 0
2: 0
3: 23
4: 197
1113195115_1113195117 -4 Left 1113195115 13:107794364-107794386 CCGGTACTATTAGAATTGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1113195117 13:107794383-107794405 TCAGCCCTTGAACTGGAAAGAGG 0: 1
1: 0
2: 1
3: 15
4: 170
1113195115_1113195123 30 Left 1113195115 13:107794364-107794386 CCGGTACTATTAGAATTGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1113195123 13:107794417-107794439 TGAGAATGTTAATGATGACAGGG 0: 1
1: 0
2: 2
3: 30
4: 313
1113195115_1113195121 5 Left 1113195115 13:107794364-107794386 CCGGTACTATTAGAATTGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1113195121 13:107794392-107794414 GAACTGGAAAGAGGGAGACAAGG 0: 1
1: 0
2: 4
3: 100
4: 1184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113195115 Original CRISPR CTGAGCAATTCTAATAGTAC CGG (reversed) Intronic
906880113 1:49580556-49580578 CTGAGCATTTCTTGTAGAACTGG + Intronic
911034593 1:93527508-93527530 CTGAGGAATTCTCAGAGCACAGG + Intronic
913280448 1:117180555-117180577 CTCAGCTTTTCTAACAGTACAGG - Intronic
915867859 1:159524714-159524736 TTGAGCATTTCTAGTAGAACTGG + Intergenic
916667616 1:166980770-166980792 CAGAGCAATTCTTATACTAGTGG + Intronic
918583224 1:186157032-186157054 CTTAGCAATTCTAGTAGAAATGG + Intronic
918801197 1:188974258-188974280 CTGTGAAATTCTAATAGTCATGG + Intergenic
922301417 1:224304471-224304493 CTTAGCAATACTAATAGTAATGG - Intronic
923926813 1:238637903-238637925 CTGAGCAAATGTAATAATCCAGG - Intergenic
1063648558 10:7910175-7910197 CTGAGGAACTCTAAGAGTTCAGG - Intronic
1065031485 10:21590764-21590786 CTGAACAATTCTATTTGGACTGG - Intronic
1066170524 10:32838957-32838979 TTTAGCAGTTCTTATAGTACTGG - Intronic
1067270178 10:44784763-44784785 CTGACCAATTCCATTAGCACAGG + Intergenic
1068174240 10:53437200-53437222 CTGAGTTATTCAAATTGTACTGG + Intergenic
1069397530 10:68006309-68006331 TTTAGCATTTCTTATAGTACAGG + Intronic
1072853241 10:98919537-98919559 CTAAGCTAATCTAACAGTACAGG + Intronic
1079571848 11:21952957-21952979 GTGATGAATTCTAACAGTACTGG - Intergenic
1080971164 11:37279093-37279115 CTGAAAAATTCTAATAGTTTAGG + Intergenic
1081578892 11:44338280-44338302 TTGGGCAATTCAAATAGTGCTGG - Intergenic
1081799765 11:45849932-45849954 CAGAACAATTCTAACAGAACTGG - Intronic
1085925335 11:81012341-81012363 TTGAGCATTTCTTATAATACTGG - Intergenic
1087291005 11:96320500-96320522 CTGAGCAGATCTAATAGGAGTGG + Intronic
1101785087 12:107875590-107875612 CTGATCACTTCTAAAAGAACCGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1110955415 13:81547146-81547168 CTTTGCAATGCTAATAGTCCAGG - Intergenic
1111186451 13:84742923-84742945 CTGAGCAATGCTAAAGGAACGGG - Intergenic
1113195115 13:107794364-107794386 CTGAGCAATTCTAATAGTACCGG - Intronic
1115431794 14:33328040-33328062 CTCAGCAATTCTATTGGCACTGG + Intronic
1116606049 14:46996890-46996912 CTGAGCAAATCTAACAGCAAGGG + Intronic
1125451579 15:39813320-39813342 CTGAGCATTTCTTGCAGTACAGG + Intronic
1127701414 15:61505112-61505134 ATGAGCACCTCTAATAGTAGGGG + Intergenic
1128399975 15:67268523-67268545 CTGTGCAGTTCTGATAGTGCTGG - Intronic
1128741409 15:70086325-70086347 CTGATTAATTCTGATAATACTGG - Intronic
1148401475 17:47365919-47365941 CTGAGCTATTTTAATATTAAAGG + Intronic
1149021863 17:51976988-51977010 CTTAGCAAAACTAATAGAACAGG + Intronic
1152026945 17:77816001-77816023 CTGAGCATTTCTCATAGAATTGG - Intergenic
1154090177 18:11351042-11351064 CTTAGCAATTGTTGTAGTACTGG - Intergenic
1159382451 18:67678904-67678926 TTGAGCATTTCTACTAGTTCAGG + Intergenic
927123037 2:19986416-19986438 CTCAGGAATTCTAATAGAAGAGG + Intronic
930751773 2:54941498-54941520 CTTAGCAACTCTAACAATACAGG - Intronic
932464626 2:71909466-71909488 CTGAACAATTCTAAGAGATCAGG + Intergenic
933618000 2:84504168-84504190 TTGATCAATTCTAATATTAAAGG + Intergenic
934545244 2:95208796-95208818 CTGAGCAATTCCATAAGCACTGG - Intronic
935612745 2:105042783-105042805 CTGAGCAATTATTATAGACCAGG - Intronic
937651911 2:124328683-124328705 CTGAACAGTTCTAATAGGATGGG + Intronic
939095045 2:137824808-137824830 CTTAGCACTGCTAATGGTACTGG - Intergenic
939483195 2:142776051-142776073 TTTAGCAATTCTTGTAGTACAGG + Intergenic
939818430 2:146925343-146925365 TTTAGCATTTCTTATAGTACAGG - Intergenic
942501789 2:176598813-176598835 CTCAGCAATGCTTATATTACTGG - Intergenic
943027165 2:182643650-182643672 AAGAGCAATGCTAATAGTTCTGG - Intergenic
943751978 2:191519016-191519038 CTGAGCAATTATCATTTTACAGG + Intergenic
1168736255 20:140002-140024 TTGAGCATTTCTTATAGGACTGG - Intergenic
1169947913 20:11009285-11009307 CGGAGCAAGGCTAATAGTCCTGG - Intergenic
1171007705 20:21483371-21483393 CTCAGCAAATGTAATAGAACAGG - Intergenic
1181933071 22:26418264-26418286 CTGAGCGATACTAATAGTTTAGG + Intergenic
1183805980 22:40211439-40211461 CTGAACTATTCTAGTAGTTCAGG + Intronic
950989030 3:17411634-17411656 CTAAGAAATTGTAAAAGTACAGG + Intronic
953803834 3:46051064-46051086 CTAAGCCATTCTAATGGTAAGGG + Intergenic
957439914 3:80232164-80232186 CTCATCAATTCTAATAGGATAGG - Intergenic
959346570 3:105202475-105202497 TTGAGCATTTCTTATAGCACAGG + Intergenic
959944759 3:112114899-112114921 CTGAGAGGTTCAAATAGTACAGG + Intronic
960152900 3:114269301-114269323 TTTAGCAATTCTTATAGTGCTGG + Intergenic
960869106 3:122231344-122231366 CTGATCAATTCAATTAGTAAAGG + Intronic
963292541 3:143506756-143506778 CTCAGTAAATCTAATAGTACTGG + Intronic
964140577 3:153394814-153394836 CTTAGCATTTCTTATAGGACAGG + Intergenic
964443596 3:156737795-156737817 ATGAGCAATTCAAATAGTCAAGG - Intergenic
965021153 3:163233189-163233211 TTTAGCAATTCTAATATTTCAGG - Intergenic
967377997 3:188827084-188827106 CTGAGCAATTTTCATATTAATGG + Intronic
968428912 4:543189-543211 TTCAGCATTTCTTATAGTACAGG + Intergenic
968430359 4:554846-554868 CTGGGCAATTCTGGTAGCACTGG + Intergenic
970109248 4:12618925-12618947 CTCAGAAATTCTAATTGCACTGG + Intergenic
970716545 4:18933147-18933169 CTGTTCCATTCTAACAGTACTGG + Intergenic
976485865 4:85603974-85603996 TTTAGCAATTCTAAAAATACTGG - Intronic
976806171 4:89050028-89050050 CTGAGAAAGACAAATAGTACAGG + Intronic
977993998 4:103480813-103480835 ATGAGCAATTAGAATAGGACAGG - Intergenic
978571762 4:110145435-110145457 CTGAGCAGTTCCCATAGTAAAGG + Intronic
978764113 4:112386808-112386830 CTGACTAATACTAATAATACAGG - Intronic
979508420 4:121524561-121524583 GTGAGCACTAATAATAGTACTGG + Intergenic
980669880 4:135991189-135991211 CTGAGCAATACTAGTAGAAGTGG - Intergenic
982680955 4:158429388-158429410 GTTAGCAATTCTTTTAGTACAGG - Intronic
982744564 4:159093523-159093545 CTTTGCAATGCTAAGAGTACTGG - Intergenic
983424172 4:167561048-167561070 CTTACCACTTCTAATAGTATTGG - Intergenic
984234462 4:177138873-177138895 TTGAGCAGTTCTTATAGTGCTGG - Intergenic
984587567 4:181580842-181580864 CTGAGCAATTCTGAACCTACAGG - Intergenic
987776943 5:22379598-22379620 CTGTGCAATTCTAATTCTTCTGG + Intronic
991546523 5:67787928-67787950 CTCAGCTATTCTAATACTTCTGG + Intergenic
993137522 5:83988926-83988948 TTGAGCAATTCTACAAGTAGTGG - Intronic
993844705 5:92926448-92926470 CTGAGCAATTTTAATATTTCTGG - Intergenic
995260841 5:110102995-110103017 CAGAGAGATTCTAATAATACTGG + Intergenic
998950714 5:147390743-147390765 CTGGGCAATTTTAATATTATAGG + Intergenic
1000158886 5:158580329-158580351 TTGAGCAGTTCTTATAGTGCTGG + Intergenic
1000605646 5:163324770-163324792 TTGAGCAATTCTCATAGCAAGGG + Intergenic
1009389531 6:63129354-63129376 CTTAGCAGTTCTTATAGTGCTGG + Intergenic
1011406448 6:87020193-87020215 ATGAGCAACTCAAATATTACTGG + Intergenic
1013190201 6:107796382-107796404 CTCAGCATCTCTAATAATACAGG - Intronic
1016240598 6:141925216-141925238 CTTAGCATGTCTCATAGTACAGG - Intergenic
1018512469 6:164540273-164540295 CTGAGAAATTCTTGTAATACAGG - Intergenic
1018774814 6:167004339-167004361 CTGATCACTTCTAATAATAAGGG - Exonic
1022226854 7:28371925-28371947 CTGGGCCATTCAAATGGTACAGG - Intronic
1023293948 7:38695540-38695562 CATAGCAATTAAAATAGTACAGG + Intergenic
1026277021 7:68888932-68888954 CTGCCCAATTCTAAAAGCACAGG - Intergenic
1030768313 7:113440127-113440149 TTGAGCATTTCTCATAGGACAGG + Intergenic
1035030642 7:155856326-155856348 CTGAGCCATGCTAATGGGACAGG - Intergenic
1038821486 8:30955997-30956019 AGGAGCAATTCTAATATTCCTGG + Intergenic
1040939737 8:52819994-52820016 CTGAACAATTATAATAGAATGGG + Intergenic
1040963178 8:53057123-53057145 TTGGGCAATTCTAAAAGTATAGG - Intergenic
1041024107 8:53666414-53666436 CTGAGTTATTTTAAGAGTACAGG + Intergenic
1041567908 8:59301423-59301445 AGGAGCAATTCTAAAAGCACTGG - Intergenic
1041869110 8:62613779-62613801 TTGATCAATTCTAATATTAAAGG + Intronic
1050971673 9:11884494-11884516 CTGAACAATTCTCAAAGTAAGGG + Intergenic
1051073124 9:13197418-13197440 CTGAGCAATTCTAACACTATCGG + Intronic
1051527336 9:18060724-18060746 CTGAGAATTTCTAAAAGTTCAGG - Intergenic
1188019694 X:25143796-25143818 CTGTGCAGTGCTAATAGTTCTGG + Intergenic
1189772484 X:44440203-44440225 CTGAGCAATTATAAGAGTTAGGG - Intergenic
1191835599 X:65458470-65458492 CTCAGCAAATCTAAAAGAACAGG + Intronic
1194094791 X:89625870-89625892 CTGAGCAAATCTAATAAGAAAGG - Intergenic
1194155659 X:90385127-90385149 TAAAGCAATTCTAATTGTACAGG + Intergenic
1195071720 X:101287610-101287632 CTGACCACTTCTGGTAGTACTGG + Intronic
1198323772 X:135546165-135546187 CTGAGGAATTCTTATAATTCAGG - Intronic
1200447427 Y:3282024-3282046 CTGAGCAAATCTAATAAGAAAGG - Intergenic