ID: 1113202545

View in Genome Browser
Species Human (GRCh38)
Location 13:107883071-107883093
Sequence CTGTATTTGTAGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113202545_1113202551 8 Left 1113202545 13:107883071-107883093 CCCTCTCCCCTCTACAAATACAG No data
Right 1113202551 13:107883102-107883124 TGTAAAGTAGGTCTATTTATTGG No data
1113202545_1113202550 -4 Left 1113202545 13:107883071-107883093 CCCTCTCCCCTCTACAAATACAG No data
Right 1113202550 13:107883090-107883112 ACAGACAATCTCTGTAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113202545 Original CRISPR CTGTATTTGTAGAGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr