ID: 1113208151

View in Genome Browser
Species Human (GRCh38)
Location 13:107941630-107941652
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113208148_1113208151 -9 Left 1113208148 13:107941616-107941638 CCTAACCAGTCAGGCTTGTTGCC No data
Right 1113208151 13:107941630-107941652 CTTGTTGCCATGAGGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113208151 Original CRISPR CTTGTTGCCATGAGGATACC AGG Intergenic
No off target data available for this crispr