ID: 1113211113

View in Genome Browser
Species Human (GRCh38)
Location 13:107982325-107982347
Sequence CAGAGCTTCTACCCACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113211113_1113211115 -10 Left 1113211113 13:107982325-107982347 CCCTCTTGTGGGTAGAAGCTCTG No data
Right 1113211115 13:107982338-107982360 AGAAGCTCTGCCAAACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113211113 Original CRISPR CAGAGCTTCTACCCACAAGA GGG (reversed) Intergenic
No off target data available for this crispr