ID: 1113217262

View in Genome Browser
Species Human (GRCh38)
Location 13:108056776-108056798
Sequence ATTCTAATCATCTGTGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113217261_1113217262 29 Left 1113217261 13:108056724-108056746 CCTAAAATAGCAAAACTTGAGGA No data
Right 1113217262 13:108056776-108056798 ATTCTAATCATCTGTGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113217262 Original CRISPR ATTCTAATCATCTGTGACAT AGG Intergenic
No off target data available for this crispr