ID: 1113217764

View in Genome Browser
Species Human (GRCh38)
Location 13:108062012-108062034
Sequence TGTCATTTCAGGATTGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113217764_1113217768 25 Left 1113217764 13:108062012-108062034 CCATGACCAATCCTGAAATGACA No data
Right 1113217768 13:108062060-108062082 AATTCAAAATACCTGTTTTGAGG 0: 7
1: 251
2: 552
3: 671
4: 1085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113217764 Original CRISPR TGTCATTTCAGGATTGGTCA TGG (reversed) Intergenic
No off target data available for this crispr