ID: 1113220242

View in Genome Browser
Species Human (GRCh38)
Location 13:108092544-108092566
Sequence CTGTATGAGCAGAAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113220242_1113220250 21 Left 1113220242 13:108092544-108092566 CCATCCCCCTTCTGCTCATACAG No data
Right 1113220250 13:108092588-108092610 CAAGTTGATGAGAGTAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113220242 Original CRISPR CTGTATGAGCAGAAGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr