ID: 1113225428

View in Genome Browser
Species Human (GRCh38)
Location 13:108154118-108154140
Sequence TTAAATGAGCTTCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113225428_1113225432 27 Left 1113225428 13:108154118-108154140 CCTTCCTCCTGAAGCTCATTTAA No data
Right 1113225432 13:108154168-108154190 CTTCCTACCTGTGCTACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113225428 Original CRISPR TTAAATGAGCTTCAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr