ID: 1113226561

View in Genome Browser
Species Human (GRCh38)
Location 13:108166443-108166465
Sequence AGCCTCCATCTTTGGCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113226561_1113226569 10 Left 1113226561 13:108166443-108166465 CCAGAGTGCCAAAGATGGAGGCT No data
Right 1113226569 13:108166476-108166498 TAGGGTGAGTTAGGTGGCTGTGG No data
1113226561_1113226564 -8 Left 1113226561 13:108166443-108166465 CCAGAGTGCCAAAGATGGAGGCT No data
Right 1113226564 13:108166458-108166480 TGGAGGCTCCCTAAAAGATAGGG No data
1113226561_1113226563 -9 Left 1113226561 13:108166443-108166465 CCAGAGTGCCAAAGATGGAGGCT No data
Right 1113226563 13:108166457-108166479 ATGGAGGCTCCCTAAAAGATAGG No data
1113226561_1113226568 4 Left 1113226561 13:108166443-108166465 CCAGAGTGCCAAAGATGGAGGCT No data
Right 1113226568 13:108166470-108166492 AAAAGATAGGGTGAGTTAGGTGG No data
1113226561_1113226570 25 Left 1113226561 13:108166443-108166465 CCAGAGTGCCAAAGATGGAGGCT No data
Right 1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG No data
1113226561_1113226567 1 Left 1113226561 13:108166443-108166465 CCAGAGTGCCAAAGATGGAGGCT No data
Right 1113226567 13:108166467-108166489 CCTAAAAGATAGGGTGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113226561 Original CRISPR AGCCTCCATCTTTGGCACTC TGG (reversed) Intergenic
No off target data available for this crispr