ID: 1113226562

View in Genome Browser
Species Human (GRCh38)
Location 13:108166451-108166473
Sequence TTTTAGGGAGCCTCCATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113226562_1113226568 -4 Left 1113226562 13:108166451-108166473 CCAAAGATGGAGGCTCCCTAAAA No data
Right 1113226568 13:108166470-108166492 AAAAGATAGGGTGAGTTAGGTGG No data
1113226562_1113226567 -7 Left 1113226562 13:108166451-108166473 CCAAAGATGGAGGCTCCCTAAAA No data
Right 1113226567 13:108166467-108166489 CCTAAAAGATAGGGTGAGTTAGG No data
1113226562_1113226571 29 Left 1113226562 13:108166451-108166473 CCAAAGATGGAGGCTCCCTAAAA No data
Right 1113226571 13:108166503-108166525 TAATATAATGGTTTTCAAACAGG No data
1113226562_1113226570 17 Left 1113226562 13:108166451-108166473 CCAAAGATGGAGGCTCCCTAAAA No data
Right 1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG No data
1113226562_1113226569 2 Left 1113226562 13:108166451-108166473 CCAAAGATGGAGGCTCCCTAAAA No data
Right 1113226569 13:108166476-108166498 TAGGGTGAGTTAGGTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113226562 Original CRISPR TTTTAGGGAGCCTCCATCTT TGG (reversed) Intergenic
No off target data available for this crispr