ID: 1113226565

View in Genome Browser
Species Human (GRCh38)
Location 13:108166466-108166488
Sequence CTAACTCACCCTATCTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113226565_1113226570 2 Left 1113226565 13:108166466-108166488 CCCTAAAAGATAGGGTGAGTTAG No data
Right 1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG No data
1113226565_1113226571 14 Left 1113226565 13:108166466-108166488 CCCTAAAAGATAGGGTGAGTTAG No data
Right 1113226571 13:108166503-108166525 TAATATAATGGTTTTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113226565 Original CRISPR CTAACTCACCCTATCTTTTA GGG (reversed) Intergenic
No off target data available for this crispr