ID: 1113226570

View in Genome Browser
Species Human (GRCh38)
Location 13:108166491-108166513
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113226561_1113226570 25 Left 1113226561 13:108166443-108166465 CCAGAGTGCCAAAGATGGAGGCT No data
Right 1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG No data
1113226562_1113226570 17 Left 1113226562 13:108166451-108166473 CCAAAGATGGAGGCTCCCTAAAA No data
Right 1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG No data
1113226565_1113226570 2 Left 1113226565 13:108166466-108166488 CCCTAAAAGATAGGGTGAGTTAG No data
Right 1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG No data
1113226566_1113226570 1 Left 1113226566 13:108166467-108166489 CCTAAAAGATAGGGTGAGTTAGG No data
Right 1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113226570 Original CRISPR GGCTGTGGATGTTAATATAA TGG Intergenic