ID: 1113226571

View in Genome Browser
Species Human (GRCh38)
Location 13:108166503-108166525
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113226565_1113226571 14 Left 1113226565 13:108166466-108166488 CCCTAAAAGATAGGGTGAGTTAG No data
Right 1113226571 13:108166503-108166525 TAATATAATGGTTTTCAAACAGG No data
1113226566_1113226571 13 Left 1113226566 13:108166467-108166489 CCTAAAAGATAGGGTGAGTTAGG No data
Right 1113226571 13:108166503-108166525 TAATATAATGGTTTTCAAACAGG No data
1113226562_1113226571 29 Left 1113226562 13:108166451-108166473 CCAAAGATGGAGGCTCCCTAAAA No data
Right 1113226571 13:108166503-108166525 TAATATAATGGTTTTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113226571 Original CRISPR TAATATAATGGTTTTCAAAC AGG Intergenic
No off target data available for this crispr