ID: 1113227616

View in Genome Browser
Species Human (GRCh38)
Location 13:108176371-108176393
Sequence TCTCCCTGATGGGTTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113227616_1113227622 0 Left 1113227616 13:108176371-108176393 CCCCCAGGAACCCATCAGGGAGA No data
Right 1113227622 13:108176394-108176416 CTCTGAATTGCTTTGATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113227616 Original CRISPR TCTCCCTGATGGGTTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr