ID: 1113228474

View in Genome Browser
Species Human (GRCh38)
Location 13:108184998-108185020
Sequence TGTAAATGAGGTCACTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113228474_1113228476 -1 Left 1113228474 13:108184998-108185020 CCTCTACAGTGACCTCATTTACA No data
Right 1113228476 13:108185020-108185042 ATAATTAACAAAATCCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113228474 Original CRISPR TGTAAATGAGGTCACTGTAG AGG (reversed) Intergenic
No off target data available for this crispr