ID: 1113231481

View in Genome Browser
Species Human (GRCh38)
Location 13:108217813-108217835
Sequence TGTACACTTCAGTGCACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113231477_1113231481 12 Left 1113231477 13:108217778-108217800 CCAAGGGAGGGGAGGCACACATC 0: 1
1: 0
2: 3
3: 13
4: 194
Right 1113231481 13:108217813-108217835 TGTACACTTCAGTGCACAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1113231476_1113231481 13 Left 1113231476 13:108217777-108217799 CCCAAGGGAGGGGAGGCACACAT 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1113231481 13:108217813-108217835 TGTACACTTCAGTGCACAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113231481 Original CRISPR TGTACACTTCAGTGCACAGG GGG Intronic
902418113 1:16254709-16254731 CTTCCACTTCAGAGCACAGGGGG + Intronic
905297929 1:36966155-36966177 GGTGCACATCAGTGCACAGATGG - Intronic
911153477 1:94617769-94617791 TGTAAACTTCATGGCACTGGTGG - Intergenic
912254387 1:108044319-108044341 AGGACACTTCTGTGCACAGTGGG - Intergenic
912276278 1:108261998-108262020 TGTCCACTTCTGTGGAAAGGGGG + Intergenic
912291950 1:108432360-108432382 TGTCCACTTCTGTGGAAAGGGGG - Intronic
912894898 1:113576178-113576200 TGTTCACTTCCCTGCAAAGGGGG - Intronic
918289810 1:183096045-183096067 TATACACTTCAGTAAACTGGAGG - Intronic
922960824 1:229644456-229644478 TGCATTCTTCAGTGCACAGCTGG - Intronic
922996504 1:229966576-229966598 TATAGGCTTCAGTGCACAGAAGG + Intergenic
924887767 1:248238368-248238390 TGTACACTTCAGTTCAGAGAAGG - Intergenic
1063575629 10:7259579-7259601 TGTGCCCTTCAGTGGACATGTGG - Intronic
1067820207 10:49521682-49521704 GATACAGTTCAGTGCAGAGGAGG + Intronic
1068875018 10:61986614-61986636 TGGACATTTTAATGCACAGGGGG - Intronic
1071966825 10:90859856-90859878 TTCACCCTTCAGTGCAGAGGAGG + Intergenic
1075727413 10:124617626-124617648 TGTTCACCTCAGGGCAGAGGTGG + Exonic
1082993904 11:59233717-59233739 TGTCCACTCCAGTGGAAAGGAGG + Intergenic
1083390820 11:62348742-62348764 GAAACAATTCAGTGCACAGGAGG - Intronic
1085972605 11:81611634-81611656 TGTACACTCCAGTGCGTTGGTGG + Intergenic
1089073020 11:115715963-115715985 TGAAGACTTCAGTGAAGAGGAGG - Intergenic
1089094065 11:115903622-115903644 TGGACAGTTCAGTGCACAATAGG + Intergenic
1090882471 11:130846181-130846203 TTTACATTTCAGTGCAAATGTGG - Intergenic
1093382066 12:18505152-18505174 TCTACATCTCAGTGGACAGGAGG - Intronic
1096426657 12:51509754-51509776 AGTACCCTAAAGTGCACAGGTGG - Exonic
1097267415 12:57754465-57754487 TGTTCACTTCAGTGTAGTGGAGG + Intronic
1099643597 12:85321869-85321891 TTCAAACTTCAGTTCACAGGTGG - Intergenic
1100276949 12:93080321-93080343 GAAACAATTCAGTGCACAGGAGG - Intergenic
1100667468 12:96770554-96770576 TTTACCCTTCAGTGAACTGGAGG + Intronic
1103660939 12:122516303-122516325 TGTACAATAAAGAGCACAGGAGG - Intronic
1104681789 12:130757175-130757197 TGGAGACTTCACTGCACATGTGG - Intergenic
1111999575 13:95197153-95197175 TGAACACTGCACTGCACACGGGG + Intronic
1112099572 13:96172655-96172677 TGTAGAGTTCAGTCCACAAGTGG + Intronic
1112488022 13:99837121-99837143 TCTTGCCTTCAGTGCACAGGTGG + Intronic
1113231481 13:108217813-108217835 TGTACACTTCAGTGCACAGGGGG + Intronic
1124592191 15:31063320-31063342 TGGACAGTGCAGGGCACAGGTGG - Intronic
1125533979 15:40432425-40432447 TGCACAGTGCAGAGCACAGGTGG + Intronic
1129239534 15:74243268-74243290 TGTAAAGTGCTGTGCACAGGAGG + Intronic
1130878200 15:88032377-88032399 TGCACACTTCGGGGCACTGGAGG + Intronic
1131267156 15:90923160-90923182 AGCTGACTTCAGTGCACAGGGGG + Intergenic
1132659817 16:1056278-1056300 TGAACACTTCTGGGCACAGCAGG + Intergenic
1132858585 16:2058553-2058575 TGTTCACTCCTGCGCACAGGCGG - Intronic
1133074367 16:3268632-3268654 TCTACACATCAGTGCAGAGCTGG + Intronic
1133523953 16:6585709-6585731 TGTTCACTGCAGTTCAAAGGGGG + Intronic
1135242113 16:20816822-20816844 TGTACCCACCAGTGTACAGGTGG + Intronic
1135642259 16:24130842-24130864 GCCACACTTCAGTGCAAAGGAGG + Intronic
1137582040 16:49639498-49639520 AGCAGACTTCAGTGCTCAGGTGG + Intronic
1138384151 16:56625113-56625135 TGGAGACTTAAGTGCAAAGGAGG + Intergenic
1139750872 16:69108080-69108102 TGTAGACCTCAGTGAACATGGGG + Intronic
1143510030 17:7390270-7390292 TGTACACTGCAGGGGACAGAAGG - Exonic
1146300571 17:31685992-31686014 TGGAAACTTCAGTCCTCAGGAGG + Intergenic
1148834669 17:50459759-50459781 TATCCATTTCAGTGCACAGGTGG - Intronic
1153492600 18:5664801-5664823 TCTAAACTTCAGAGAACAGGTGG - Intergenic
1155071737 18:22322805-22322827 TGTTCACTGCAGGGCCCAGGAGG - Intergenic
1155255746 18:23996780-23996802 TCTCCACTTCAGGGCATAGGTGG + Intronic
1158601694 18:58861783-58861805 TGTACTCTTCAATGCACATACGG + Intergenic
1161743800 19:6042563-6042585 TGCAGGCTGCAGTGCACAGGGGG + Intronic
1166368970 19:42291099-42291121 TGTCCAGTTCATTGCCCAGGGGG + Exonic
1167693333 19:51000563-51000585 AGGACACTCCAGGGCACAGGAGG - Exonic
926516027 2:13847590-13847612 TGTACATTTATGTGCACATGTGG + Intergenic
928681315 2:33705564-33705586 TGTACAATTTAGAACACAGGTGG + Intergenic
928957427 2:36884399-36884421 TGTTTAATTCAGTGCACAGTAGG - Intronic
931160391 2:59683811-59683833 TGTAGTTTTTAGTGCACAGGCGG + Intergenic
933690829 2:85178450-85178472 TGGAGACTTGGGTGCACAGGAGG - Intronic
938142871 2:128811183-128811205 TGCAAACTTCAGTGCACACCTGG - Intergenic
939968486 2:148634711-148634733 TCTACACCTGAGTGCACACGTGG + Intergenic
942256369 2:174103527-174103549 TCTACAGTTTAGAGCACAGGTGG - Intronic
945280884 2:208034380-208034402 TGGACAATTTAGTGGACAGGAGG - Intergenic
947866886 2:233404338-233404360 TGTGCATTTCAGATCACAGGAGG + Intronic
1169574383 20:6941961-6941983 TGTTCACATCAGTGCACAATGGG - Intergenic
1170671361 20:18437067-18437089 TGATCACTTGAGTTCACAGGAGG + Intronic
1171183492 20:23108494-23108516 TGTGCACGTAGGTGCACAGGTGG + Intergenic
1173053430 20:39587995-39588017 TGTTCACTACAGAGCACAGTTGG - Intergenic
1173109579 20:40174180-40174202 TGGACACTTAAGGGCCCAGGTGG - Intergenic
1173309156 20:41881387-41881409 GGTTCACTTCAGTGCAGAAGAGG + Intergenic
1174739119 20:52994889-52994911 TGTACATTACAGTGCACTTGAGG + Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1180990656 22:19933796-19933818 AGGACACTGGAGTGCACAGGTGG - Intronic
1182432851 22:30310796-30310818 TGTATAGTTTAGTGCTCAGGTGG - Intronic
1183929842 22:41229727-41229749 TCTACTCTTCTGTGCCCAGGTGG - Exonic
953225333 3:41013727-41013749 TGGCCACTTCTGTGCATAGGTGG + Intergenic
955852210 3:63232649-63232671 TCTACACTTCACAGCACAGTTGG - Intronic
956641200 3:71417123-71417145 AATACACTTCAGACCACAGGTGG + Intronic
958805885 3:98809492-98809514 TGTTCACTGCAGTGAAAAGGGGG - Intronic
966383353 3:179366838-179366860 TCTTCACTTCAGTGCCCAAGTGG + Intronic
976370630 4:84284638-84284660 TTTACCCTTCAGTGAGCAGGAGG - Intergenic
977091345 4:92680349-92680371 TGTACTCTTCAGTGAACTGTAGG + Intronic
980382275 4:132038178-132038200 TGTGCACTCAAGTGCACAGAAGG - Intergenic
983225598 4:165083130-165083152 TAAACTCTTCAGTGCTCAGGGGG + Intronic
986798398 5:11234558-11234580 TGTTCACCACAGTGCACTGGGGG + Intronic
992626378 5:78639120-78639142 TGTACACCTGTGTGGACAGGTGG - Intronic
995333405 5:110971330-110971352 TGTTCACTTTACTGCCCAGGTGG - Intergenic
999931888 5:156442526-156442548 TGTATATTTCAGTCCACAGTAGG + Intronic
1000104851 5:158049650-158049672 TGCACACCTGAGTGCAGAGGAGG - Intergenic
1003883993 6:10504401-10504423 TGTGCACTTCAGTGGCCAGGAGG + Intronic
1004482324 6:16032610-16032632 TGTAAACATGAGTGCCCAGGAGG - Intergenic
1017321637 6:153101357-153101379 TGTACACTCAAGTGCCCAGTTGG - Intronic
1017714375 6:157198469-157198491 GGTACACGTCAGTGGACAGGCGG + Intronic
1018090119 6:160339151-160339173 GGGACACTTCAGAGCTCAGGGGG - Intergenic
1019548223 7:1588750-1588772 TGTCCACTTAAGTGCACTGTGGG - Intergenic
1020130063 7:5554826-5554848 TGTACACACAAGTGCACTGGGGG + Intronic
1022650910 7:32273581-32273603 TATTCACTTCAGGGCTCAGGTGG + Intronic
1022858981 7:34345906-34345928 TGTTCACTTCAATCCACAGAAGG + Intergenic
1023937709 7:44751074-44751096 CTTACTCTTCACTGCACAGGGGG - Intronic
1034335655 7:150322011-150322033 TGTTCACTTTGGTGCACATGTGG + Intronic
1035326340 7:158068326-158068348 GGTACGGTGCAGTGCACAGGAGG + Intronic
1036171078 8:6485427-6485449 TGTAAACTTCAGCACACAGAAGG - Intronic
1036182906 8:6600356-6600378 TGTAGCCCTCAGCGCACAGGTGG + Intronic
1038247031 8:25867987-25868009 TGTACATTTCAGTGGGCAGAGGG - Intronic
1048276273 8:133068312-133068334 TCTACCCTTGAGTGCCCAGGAGG + Intronic
1049553778 8:143272415-143272437 TGTACACGTCTGGGGACAGGCGG - Intronic
1049806865 8:144545044-144545066 TCTTCACCTCAGTGCCCAGGTGG + Intronic
1052995622 9:34550403-34550425 AGGACACATCTGTGCACAGGTGG + Intergenic
1057140378 9:92723127-92723149 TGTACACAGTAGTGCGCAGGTGG + Intronic
1057645512 9:96871208-96871230 TGTATGCTTCAGTGCTCTGGAGG - Intronic
1061667756 9:132170220-132170242 TTTACAATTCAGTTCTCAGGTGG - Intronic
1185735402 X:2492001-2492023 TGTCCAGTACAGTGCTCAGGAGG + Intronic
1196587178 X:117443599-117443621 TGTACACTCCCCTGCAAAGGGGG + Intergenic
1198087921 X:133298040-133298062 TGTACATTTAATTGCACATGTGG + Intergenic
1199583261 X:149382204-149382226 TGTCCTCTTCCGTGCAAAGGGGG + Intergenic