ID: 1113232293

View in Genome Browser
Species Human (GRCh38)
Location 13:108226215-108226237
Sequence GTCTAGTGGAAAATGACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113232291_1113232293 -7 Left 1113232291 13:108226199-108226221 CCAGATGATAGCTCAGGTCTAGT 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1113232293 13:108226215-108226237 GTCTAGTGGAAAATGACACAAGG 0: 1
1: 0
2: 1
3: 12
4: 153
1113232288_1113232293 22 Left 1113232288 13:108226170-108226192 CCCAACATGTCAGTGTTAGGTAT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1113232293 13:108226215-108226237 GTCTAGTGGAAAATGACACAAGG 0: 1
1: 0
2: 1
3: 12
4: 153
1113232289_1113232293 21 Left 1113232289 13:108226171-108226193 CCAACATGTCAGTGTTAGGTATA 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1113232293 13:108226215-108226237 GTCTAGTGGAAAATGACACAAGG 0: 1
1: 0
2: 1
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113232293 Original CRISPR GTCTAGTGGAAAATGACACA AGG Intronic
900213909 1:1471071-1471093 GGGTAATGGAAAATGACAAAGGG - Intergenic
904379820 1:30103171-30103193 GTCTTATGGACAATGACTCAGGG + Intergenic
907685547 1:56608004-56608026 GACTAAAGGAAAATCACACAAGG + Intronic
909786256 1:79617690-79617712 GTCTGGAGGGTAATGACACAGGG - Intergenic
913029653 1:114887781-114887803 CTCTACTGGCAAATGACAGAGGG - Intronic
913573367 1:120143748-120143770 GGTTAGTGGAAAATGATCCAAGG + Intergenic
914294624 1:146308546-146308568 GGTTAGTGGAAAATGATCCAAGG + Intergenic
914555667 1:148759329-148759351 GGTTAGTGGAAAATGATCCAAGG + Intergenic
915234443 1:154470169-154470191 GTCTTGCAGAAAGTGACACAGGG + Intronic
916282232 1:163064455-163064477 ATCTAGTGGTAAAGGACTCAGGG + Intergenic
916327033 1:163573968-163573990 GTCTAGTAGTATATGCCACAGGG - Intergenic
916910318 1:169339673-169339695 GACAAATGGAAAATGACAAATGG - Intronic
918309047 1:183272539-183272561 GCCTAATGGGAAATGCCACAAGG + Intronic
921778718 1:219134198-219134220 GTCTAGGGGATAATGACATGAGG - Intergenic
1065759328 10:28967257-28967279 GTCTCCTGAAAAATGACATAAGG - Intergenic
1070530645 10:77334082-77334104 GCCTGGTGGAAAATCAAACAAGG - Intronic
1074459129 10:113621038-113621060 TTCTTGTTTAAAATGACACACGG + Intronic
1076118812 10:127920220-127920242 CTCTAGTAACAAATGACACAAGG + Intronic
1077761645 11:5106391-5106413 AACTAGTGGAGAATAACACAAGG + Intergenic
1081133066 11:39404117-39404139 GCCTTGAGGAAAATGTCACATGG - Intergenic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1086273950 11:85102066-85102088 GTATCGTGGAAGATGCCACATGG - Intronic
1088747543 11:112817081-112817103 ATCTGGAGGAAACTGACACATGG + Intergenic
1090298666 11:125614151-125614173 TTTTAGTGGACAATAACACATGG + Exonic
1093832604 12:23782245-23782267 ACCTAGTTGAAAATGACACAAGG - Intronic
1094447426 12:30546588-30546610 GTGCAGGGGAAAATGCCACAGGG - Intergenic
1097513956 12:60579538-60579560 GTCTGGTGGGAAGTGGCACAGGG - Intergenic
1100187076 12:92150300-92150322 GCCCACTGGAAAATGAAACAAGG + Intergenic
1106305925 13:28509461-28509483 TTCTAGATGAAAATGACAGATGG + Intergenic
1107477265 13:40750391-40750413 GTGTATTGCAAAAGGACACAAGG + Intronic
1107494958 13:40917380-40917402 GTCTAGTGGAAAGACAAACAAGG - Intergenic
1109936818 13:69297861-69297883 GTTTAGTGGTAAATTAAACATGG + Intergenic
1111008240 13:82277575-82277597 ATCTAGTGGAAAATTTCTCATGG - Intergenic
1111008845 13:82285991-82286013 ATATAATGGAAATTGACACAAGG + Intergenic
1111873511 13:93864468-93864490 GTCTACAGAGAAATGACACAAGG - Intronic
1112174829 13:97011802-97011824 CTCTACTTGGAAATGACACAGGG - Intergenic
1113232293 13:108226215-108226237 GTCTAGTGGAAAATGACACAAGG + Intronic
1115680246 14:35730305-35730327 GGCGTGTGGAAAATGCCACAGGG + Intronic
1121363566 14:93286097-93286119 ATCTAGTGGAAAAGGAGAGAAGG - Intronic
1121943050 14:98091738-98091760 GAGGAGTGGAAAATGAGACACGG + Intergenic
1121958143 14:98233284-98233306 GACTGGTGTAAAATGACCCAAGG + Intergenic
1122596854 14:102899682-102899704 GTCTACTGGAGAATCAGACAAGG - Intronic
1126316061 15:47371045-47371067 GTCCAGTGCCAAATGAAACAAGG + Intronic
1133112746 16:3558521-3558543 TTCTAGTGCAAAATGGCAAATGG + Intronic
1136058128 16:27706057-27706079 TTCTCATTGAAAATGACACAGGG + Intronic
1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG + Exonic
1137400688 16:48152096-48152118 GTCTTGTGGAAAAGGATCCAAGG - Intronic
1141100024 16:81190792-81190814 GTCATGTGGAAAATGCCACCAGG + Intergenic
1144349619 17:14382534-14382556 GGCTAGAGGACAGTGACACAGGG + Intergenic
1146453601 17:32993294-32993316 GTCTTGGGGAAGATGCCACAGGG + Intronic
1147208631 17:38857422-38857444 TTTTATTGGAAAATGACAAAGGG - Intergenic
1147334653 17:39719962-39719984 GTGAAGTGGAAAATGACAGGAGG - Intronic
1147408965 17:40235373-40235395 GTCTAGGGAAAAACTACACAAGG - Intronic
1147894944 17:43744352-43744374 GTCTGGTATTAAATGACACACGG + Intergenic
1154245949 18:12698665-12698687 ATATAGTGGAAAATGAGACATGG - Intronic
1155474450 18:26224166-26224188 GTCTAGTGGAAATTTAGAAAGGG + Intergenic
1155724205 18:29058851-29058873 GTGTTGTGGATAATGACACCTGG + Intergenic
1159159263 18:64622352-64622374 TTCTACAGGAAAATGAGACAAGG + Intergenic
1159390911 18:67790622-67790644 TTCTTGTGGAAAATGGCACATGG + Intergenic
1159875829 18:73809797-73809819 GTCCTTTGGAAAATGTCACAGGG - Intergenic
1164219046 19:23177127-23177149 GTCCAGGGGAGAATGTCACAAGG - Intergenic
1164238778 19:23364844-23364866 TTCTATTGGAAAAAGACATATGG + Intronic
1164318963 19:24121499-24121521 TTCTACTGGAAAAAGACATATGG - Intronic
1164457163 19:28418324-28418346 GTCAAATGGAAAAATACACATGG + Intergenic
1165586108 19:36916959-36916981 GAATAGTGGAAAATTACAAAGGG - Intronic
1167720102 19:51173553-51173575 GTTTAGAGAAAAATAACACAGGG + Intergenic
1168558630 19:57364369-57364391 CTCAAGTTGAAAATGTCACATGG + Exonic
925110338 2:1330108-1330130 GGCTAGTGGAAGATGGGACAAGG + Intronic
925476468 2:4222269-4222291 TTCAAGTGGAAAAGCACACAAGG - Intergenic
925551789 2:5084293-5084315 GACCAGGGGAAAATAACACAAGG + Intergenic
928225271 2:29443101-29443123 GTTTAGTTAAAAATGCCACAGGG - Intronic
932426135 2:71636623-71636645 GTCCAGTGGGAGATGTCACATGG + Intronic
932930253 2:76027824-76027846 GTCTAGAGAAAAGTGACACAGGG - Intergenic
937868761 2:126772825-126772847 GGCTAATGGCAAATGCCACATGG + Intergenic
939549333 2:143594457-143594479 TTTTATTGGAAAATGACAAAGGG + Intronic
940350732 2:152684061-152684083 GTCTAATGGAAAAATAAACATGG + Intronic
941347689 2:164390202-164390224 GTGCAGTGGAAAATAACACTAGG + Intergenic
943343651 2:186711302-186711324 GACCAGTGGAAAATGACCCCAGG - Intronic
943801916 2:192070955-192070977 GTCGAGTGGAAAGTGACACGGGG + Intronic
944083871 2:195821541-195821563 GTCTTGTGGGTAATGGCACAGGG - Intronic
945734241 2:213578665-213578687 ATCAAGTGTAAAATGACTCAGGG + Intronic
1173375468 20:42478507-42478529 GAGAAGTGGAAAATGACTCAGGG - Intronic
1174833258 20:53833278-53833300 GTCAGGGGGATAATGACACAAGG - Intergenic
1175184785 20:57172860-57172882 CTCTACTGGAAAATGAAGCAGGG + Intronic
1177380504 21:20335720-20335742 GAAAATTGGAAAATGACACATGG + Intergenic
1177545496 21:22552813-22552835 GACTAGTAGAAAATGATTCATGG + Intergenic
1177646780 21:23908856-23908878 GTCTTGTTGACAATGACAAATGG + Intergenic
1177677926 21:24326497-24326519 GTACAGTGGAAAATGCCAAAAGG - Intergenic
1178239448 21:30881964-30881986 GTCCAGTGACAAATGAAACAGGG - Intergenic
1179624788 21:42642779-42642801 GTCTACTGAAAAATTACATAAGG - Intergenic
1180687332 22:17679868-17679890 GTGTAATAGAAATTGACACAAGG + Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1184480033 22:44740983-44741005 GTCAGATGGAAAATGACAAATGG - Intronic
950603071 3:14052568-14052590 GAGTATTGGAAAGTGACACATGG - Intronic
951752473 3:26053107-26053129 GTCTAGAGGAAAATGAGGAAGGG - Intergenic
959584539 3:108013920-108013942 GTCAAGTTCAAAATCACACAGGG + Intergenic
961953967 3:130781064-130781086 TTCTCTTGGAAAATAACACATGG - Intergenic
962496164 3:135941399-135941421 GTCTAGTGGAAATTAACTCCAGG - Intergenic
967402330 3:189077492-189077514 ATTGAGTGGAAAAAGACACAAGG + Intronic
967993900 3:195152497-195152519 GTGTTCTGGAAAGTGACACAGGG - Intronic
970071488 4:12164596-12164618 ATCTAGTGTAGAATGACACAGGG - Intergenic
970567726 4:17348859-17348881 GTATAGTGGAAAATGTCAGATGG - Intergenic
972388196 4:38587863-38587885 GTCTACTGCCAAATTACACATGG - Intergenic
974118345 4:57608183-57608205 GAGAAGTGGAAAATGATACAAGG - Intergenic
977044036 4:92046896-92046918 GTCTAGAGAAACAAGACACATGG - Intergenic
977189623 4:93983510-93983532 TTCTAGTGGAACATTAGACATGG - Intergenic
979726534 4:123969237-123969259 GTCTAGGTGAAAATCCCACAAGG - Intergenic
981625002 4:146745214-146745236 GCCTAGAGGAAAAGGGCACAGGG + Intronic
982720088 4:158850275-158850297 GTCCAGTGGAAAATAAAATAGGG - Intronic
982824011 4:159979436-159979458 TTCTAATTAAAAATGACACAGGG - Intergenic
983630561 4:169845202-169845224 CTCTATGGGAAAATGAGACATGG + Intergenic
986865731 5:11984383-11984405 GTCAACTGGAAAATGACACATGG + Intergenic
988247718 5:28709073-28709095 ATATAGTGGAAACTGTCACATGG - Intergenic
989582924 5:43050344-43050366 GTATAGGGGAAACTGTCACAAGG - Intergenic
990157487 5:52895382-52895404 GTTTATTGGTAAATGACACCGGG - Intronic
992090014 5:73308476-73308498 GTTTAGTGGAAAATTTCACTTGG + Intergenic
993022975 5:82614045-82614067 GTCTAGAGGGTAATGATACAGGG - Intergenic
993076644 5:83240350-83240372 GTCTAGAGAAAGAAGACACAAGG + Intronic
994875234 5:105413572-105413594 GCCCAGAGGAAAATGCCACAGGG + Intergenic
998730404 5:145069086-145069108 ATATAGTCTAAAATGACACATGG + Intergenic
1000883959 5:166729498-166729520 GTCTAGTTGACAATGAGACAGGG - Intergenic
1001769935 5:174287004-174287026 GTCTAAAGGAAAATGACTCTAGG + Intergenic
1003090845 6:3101522-3101544 ATCTAGGGGAGAATGACAGAGGG - Intronic
1003988282 6:11460092-11460114 ATCCTGTTGAAAATGACACAAGG - Intergenic
1004150972 6:13119838-13119860 GATTCCTGGAAAATGACACAGGG - Intronic
1004462844 6:15854373-15854395 AGCTGGTGGAAAATGACACAGGG - Intergenic
1004699942 6:18069499-18069521 ATCTATTGGAAAATGAGGCAGGG - Intergenic
1005141525 6:22637330-22637352 GTCTAGTGAAGAATGAAAGAGGG - Intergenic
1006849722 6:37089599-37089621 GTCTAGAGGAAAATGCTAGAAGG + Intergenic
1007003781 6:38340278-38340300 GTATAGAGGAAAATGACATTTGG - Intronic
1008160881 6:48073993-48074015 GTCTGATGTAAAATGACAAAAGG - Intergenic
1011039915 6:83018411-83018433 CTCTAGTGAAAAATGAAGCAAGG - Intronic
1011510755 6:88097907-88097929 GTCAGAAGGAAAATGACACAAGG - Intergenic
1011808654 6:91103251-91103273 ATCTTTTGGAAAATGACAAATGG + Intergenic
1014090137 6:117395229-117395251 TTCAAGTGGAGACTGACACAAGG + Intronic
1016923657 6:149318442-149318464 GTCTAGTTAAAGATGACTCAGGG + Intronic
1020681924 7:11247191-11247213 TTCTAATGGAGAATGAAACAGGG + Intergenic
1021242318 7:18218536-18218558 GTGTGGGGGATAATGACACAAGG + Intronic
1024041434 7:45559126-45559148 GTCTGGTAGAAAATGACAACTGG - Intergenic
1024674666 7:51627312-51627334 GTATGTTGAAAAATGACACATGG + Intergenic
1024773409 7:52753742-52753764 ATCTAGATGAAAATGACAAAAGG - Intergenic
1026113954 7:67480769-67480791 GTGTGGTGGATACTGACACAAGG - Intergenic
1030406745 7:109124401-109124423 GTCTAGTGAAATATGACATATGG + Intergenic
1030916773 7:115324602-115324624 GTATAGTTGATGATGACACATGG + Intergenic
1031066624 7:117112675-117112697 GAAGAGTGGAAAAAGACACAGGG + Intronic
1033669488 7:143477647-143477669 GCCTAGTGGTAACTGACACTAGG + Intergenic
1034291298 7:149934205-149934227 GTCGAGTGGAACTTGACACCTGG - Intergenic
1034355043 7:150444964-150444986 CTATAGTGGGAAATGACACAAGG - Intergenic
1038560748 8:28577137-28577159 GAGTAATGGAAAATGGCACAAGG + Intergenic
1039288786 8:36071607-36071629 ATGTCGTGGAAAATGTCACAAGG + Intergenic
1043190263 8:77212431-77212453 GTATAGTTGAAAAAAACACATGG - Intergenic
1045932640 8:107644975-107644997 CTATAGTGGAAAATACCACATGG - Intergenic
1046339072 8:112827799-112827821 CTCAAGTGGAAAATGATAGAGGG + Intronic
1048733294 8:137468448-137468470 GTTTTTTGGAGAATGACACATGG + Intergenic
1050754239 9:8980526-8980548 GTCTATTGGAAAATAACATTAGG + Intronic
1052015492 9:23459823-23459845 GTCAAAAGGAAAATGTCACATGG + Intergenic
1052468806 9:28866325-28866347 CACAAGTAGAAAATGACACAGGG - Intergenic
1054977686 9:71167284-71167306 GTCTTGAGGAAAATCACATAAGG - Intronic
1056283574 9:85065473-85065495 GTCTACTGGCACATGACAGAAGG + Intergenic
1059615911 9:115950401-115950423 GACTAGGGGAAAATGAAACAGGG - Intergenic
1186181686 X:6979587-6979609 TTTTATTGGAAAATGAAACAGGG + Intergenic
1186332789 X:8553951-8553973 GTCTACTGGAAGAAGACAGAAGG - Exonic
1187285078 X:17897351-17897373 TTCTAGTGGAATAAGAAACAAGG - Intergenic
1190650225 X:52562514-52562536 GGCTCTTGGCAAATGACACAGGG + Intergenic
1192405011 X:70875834-70875856 GTCTAGTGAAAAAGGAAAGAAGG + Intronic
1193390177 X:80917111-80917133 GACTAGTGGAACAGGACAGAGGG + Intergenic
1196170834 X:112587202-112587224 GGCAAGGGGAAAATGCCACAAGG + Intergenic