ID: 1113237033

View in Genome Browser
Species Human (GRCh38)
Location 13:108288831-108288853
Sequence GAGTATCTGGAGGTTAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113237033 Original CRISPR GAGTATCTGGAGGTTAGGCT AGG Intronic