ID: 1113239334

View in Genome Browser
Species Human (GRCh38)
Location 13:108318872-108318894
Sequence CTGGTGAGATTGAGGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113239334_1113239337 21 Left 1113239334 13:108318872-108318894 CCTTTTCTCCTCAATCTCACCAG No data
Right 1113239337 13:108318916-108318938 TTAGTAATAGCCTTTCTGACTGG 0: 11
1: 490
2: 2079
3: 4186
4: 5622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113239334 Original CRISPR CTGGTGAGATTGAGGAGAAA AGG (reversed) Intergenic
No off target data available for this crispr