ID: 1113239337

View in Genome Browser
Species Human (GRCh38)
Location 13:108318916-108318938
Sequence TTAGTAATAGCCTTTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12388
Summary {0: 11, 1: 490, 2: 2079, 3: 4186, 4: 5622}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113239336_1113239337 2 Left 1113239336 13:108318891-108318913 CCAGCATCTATTGTTTTTTGACT 0: 46
1: 927
2: 3520
3: 8753
4: 21047
Right 1113239337 13:108318916-108318938 TTAGTAATAGCCTTTCTGACTGG 0: 11
1: 490
2: 2079
3: 4186
4: 5622
1113239334_1113239337 21 Left 1113239334 13:108318872-108318894 CCTTTTCTCCTCAATCTCACCAG No data
Right 1113239337 13:108318916-108318938 TTAGTAATAGCCTTTCTGACTGG 0: 11
1: 490
2: 2079
3: 4186
4: 5622
1113239333_1113239337 22 Left 1113239333 13:108318871-108318893 CCCTTTTCTCCTCAATCTCACCA No data
Right 1113239337 13:108318916-108318938 TTAGTAATAGCCTTTCTGACTGG 0: 11
1: 490
2: 2079
3: 4186
4: 5622
1113239335_1113239337 13 Left 1113239335 13:108318880-108318902 CCTCAATCTCACCAGCATCTATT 0: 5
1: 103
2: 875
3: 2508
4: 8131
Right 1113239337 13:108318916-108318938 TTAGTAATAGCCTTTCTGACTGG 0: 11
1: 490
2: 2079
3: 4186
4: 5622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113239337 Original CRISPR TTAGTAATAGCCTTTCTGAC TGG Intergenic
Too many off-targets to display for this crispr