ID: 1113241973

View in Genome Browser
Species Human (GRCh38)
Location 13:108348038-108348060
Sequence GTGCTCAAGGCCAACATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113241973_1113241979 13 Left 1113241973 13:108348038-108348060 CCCTTAATGTTGGCCTTGAGCAC No data
Right 1113241979 13:108348074-108348096 ACTAAGTGCAGCCCACACCAAGG No data
1113241973_1113241982 27 Left 1113241973 13:108348038-108348060 CCCTTAATGTTGGCCTTGAGCAC No data
Right 1113241982 13:108348088-108348110 ACACCAAGGAATGCGAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113241973 Original CRISPR GTGCTCAAGGCCAACATTAA GGG (reversed) Intergenic
No off target data available for this crispr