ID: 1113242644

View in Genome Browser
Species Human (GRCh38)
Location 13:108355479-108355501
Sequence GCCCCTCTGCCTGTTCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113242644_1113242648 -7 Left 1113242644 13:108355479-108355501 CCCGTGGGAACAGGCAGAGGGGC No data
Right 1113242648 13:108355495-108355517 GAGGGGCAGGACTGGAGCAGAGG No data
1113242644_1113242649 -2 Left 1113242644 13:108355479-108355501 CCCGTGGGAACAGGCAGAGGGGC No data
Right 1113242649 13:108355500-108355522 GCAGGACTGGAGCAGAGGCTTGG No data
1113242644_1113242652 29 Left 1113242644 13:108355479-108355501 CCCGTGGGAACAGGCAGAGGGGC No data
Right 1113242652 13:108355531-108355553 TGAGGTTCCTATTAGGTCTGTGG No data
1113242644_1113242650 11 Left 1113242644 13:108355479-108355501 CCCGTGGGAACAGGCAGAGGGGC No data
Right 1113242650 13:108355513-108355535 AGAGGCTTGGTCAACGTTTGAGG No data
1113242644_1113242651 22 Left 1113242644 13:108355479-108355501 CCCGTGGGAACAGGCAGAGGGGC No data
Right 1113242651 13:108355524-108355546 CAACGTTTGAGGTTCCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113242644 Original CRISPR GCCCCTCTGCCTGTTCCCAC GGG (reversed) Intergenic
No off target data available for this crispr