ID: 1113242843

View in Genome Browser
Species Human (GRCh38)
Location 13:108359045-108359067
Sequence TTTAACCTTTTGTAGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113242840_1113242843 16 Left 1113242840 13:108359006-108359028 CCAGGAGTTGTGCTAGGCACTCA No data
Right 1113242843 13:108359045-108359067 TTTAACCTTTTGTAGGTGTAGGG No data
1113242838_1113242843 23 Left 1113242838 13:108358999-108359021 CCTGAGTCCAGGAGTTGTGCTAG No data
Right 1113242843 13:108359045-108359067 TTTAACCTTTTGTAGGTGTAGGG No data
1113242837_1113242843 30 Left 1113242837 13:108358992-108359014 CCTGGGTCCTGAGTCCAGGAGTT No data
Right 1113242843 13:108359045-108359067 TTTAACCTTTTGTAGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113242843 Original CRISPR TTTAACCTTTTGTAGGTGTA GGG Intergenic
No off target data available for this crispr