ID: 1113244429

View in Genome Browser
Species Human (GRCh38)
Location 13:108378254-108378276
Sequence AAGGGATAGCACAGTGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113244429_1113244441 30 Left 1113244429 13:108378254-108378276 CCACAGTCACTGTGCTATCCCTT No data
Right 1113244441 13:108378307-108378329 ACGTGGCTGCTACCAGGGGATGG No data
1113244429_1113244435 13 Left 1113244429 13:108378254-108378276 CCACAGTCACTGTGCTATCCCTT No data
Right 1113244435 13:108378290-108378312 GATTCTCTCTCCATGCCACGTGG No data
1113244429_1113244438 25 Left 1113244429 13:108378254-108378276 CCACAGTCACTGTGCTATCCCTT No data
Right 1113244438 13:108378302-108378324 ATGCCACGTGGCTGCTACCAGGG No data
1113244429_1113244437 24 Left 1113244429 13:108378254-108378276 CCACAGTCACTGTGCTATCCCTT No data
Right 1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG No data
1113244429_1113244439 26 Left 1113244429 13:108378254-108378276 CCACAGTCACTGTGCTATCCCTT No data
Right 1113244439 13:108378303-108378325 TGCCACGTGGCTGCTACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113244429 Original CRISPR AAGGGATAGCACAGTGACTG TGG (reversed) Intergenic
No off target data available for this crispr