ID: 1113244433

View in Genome Browser
Species Human (GRCh38)
Location 13:108378278-108378300
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113244433_1113244438 1 Left 1113244433 13:108378278-108378300 CCCGACTACATAGATTCTCTCTC No data
Right 1113244438 13:108378302-108378324 ATGCCACGTGGCTGCTACCAGGG No data
1113244433_1113244437 0 Left 1113244433 13:108378278-108378300 CCCGACTACATAGATTCTCTCTC No data
Right 1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG No data
1113244433_1113244442 7 Left 1113244433 13:108378278-108378300 CCCGACTACATAGATTCTCTCTC No data
Right 1113244442 13:108378308-108378330 CGTGGCTGCTACCAGGGGATGGG No data
1113244433_1113244439 2 Left 1113244433 13:108378278-108378300 CCCGACTACATAGATTCTCTCTC No data
Right 1113244439 13:108378303-108378325 TGCCACGTGGCTGCTACCAGGGG No data
1113244433_1113244443 12 Left 1113244433 13:108378278-108378300 CCCGACTACATAGATTCTCTCTC No data
Right 1113244443 13:108378313-108378335 CTGCTACCAGGGGATGGGAGAGG No data
1113244433_1113244441 6 Left 1113244433 13:108378278-108378300 CCCGACTACATAGATTCTCTCTC No data
Right 1113244441 13:108378307-108378329 ACGTGGCTGCTACCAGGGGATGG No data
1113244433_1113244444 17 Left 1113244433 13:108378278-108378300 CCCGACTACATAGATTCTCTCTC No data
Right 1113244444 13:108378318-108378340 ACCAGGGGATGGGAGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113244433 Original CRISPR GAGAGAGAATCTATGTAGTC GGG (reversed) Intergenic
No off target data available for this crispr