ID: 1113244435

View in Genome Browser
Species Human (GRCh38)
Location 13:108378290-108378312
Sequence GATTCTCTCTCCATGCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113244430_1113244435 -5 Left 1113244430 13:108378272-108378294 CCCTTCCCCGACTACATAGATTC No data
Right 1113244435 13:108378290-108378312 GATTCTCTCTCCATGCCACGTGG No data
1113244431_1113244435 -6 Left 1113244431 13:108378273-108378295 CCTTCCCCGACTACATAGATTCT No data
Right 1113244435 13:108378290-108378312 GATTCTCTCTCCATGCCACGTGG No data
1113244432_1113244435 -10 Left 1113244432 13:108378277-108378299 CCCCGACTACATAGATTCTCTCT No data
Right 1113244435 13:108378290-108378312 GATTCTCTCTCCATGCCACGTGG No data
1113244428_1113244435 14 Left 1113244428 13:108378253-108378275 CCCACAGTCACTGTGCTATCCCT No data
Right 1113244435 13:108378290-108378312 GATTCTCTCTCCATGCCACGTGG No data
1113244429_1113244435 13 Left 1113244429 13:108378254-108378276 CCACAGTCACTGTGCTATCCCTT No data
Right 1113244435 13:108378290-108378312 GATTCTCTCTCCATGCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113244435 Original CRISPR GATTCTCTCTCCATGCCACG TGG Intergenic
No off target data available for this crispr