ID: 1113244437

View in Genome Browser
Species Human (GRCh38)
Location 13:108378301-108378323
Sequence CATGCCACGTGGCTGCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113244432_1113244437 1 Left 1113244432 13:108378277-108378299 CCCCGACTACATAGATTCTCTCT No data
Right 1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG No data
1113244430_1113244437 6 Left 1113244430 13:108378272-108378294 CCCTTCCCCGACTACATAGATTC No data
Right 1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG No data
1113244433_1113244437 0 Left 1113244433 13:108378278-108378300 CCCGACTACATAGATTCTCTCTC No data
Right 1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG No data
1113244428_1113244437 25 Left 1113244428 13:108378253-108378275 CCCACAGTCACTGTGCTATCCCT No data
Right 1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG No data
1113244431_1113244437 5 Left 1113244431 13:108378273-108378295 CCTTCCCCGACTACATAGATTCT No data
Right 1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG No data
1113244429_1113244437 24 Left 1113244429 13:108378254-108378276 CCACAGTCACTGTGCTATCCCTT No data
Right 1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG No data
1113244434_1113244437 -1 Left 1113244434 13:108378279-108378301 CCGACTACATAGATTCTCTCTCC No data
Right 1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113244437 Original CRISPR CATGCCACGTGGCTGCTACC AGG Intergenic
No off target data available for this crispr