ID: 1113245138

View in Genome Browser
Species Human (GRCh38)
Location 13:108386798-108386820
Sequence AGAGAGAATCAGAATAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113245138_1113245141 6 Left 1113245138 13:108386798-108386820 CCATCCTTATTCTGATTCTCTCT No data
Right 1113245141 13:108386827-108386849 CTGTGAAGTGGTGTCATCTTTGG No data
1113245138_1113245140 -6 Left 1113245138 13:108386798-108386820 CCATCCTTATTCTGATTCTCTCT No data
Right 1113245140 13:108386815-108386837 CTCTCTTTGTCACTGTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113245138 Original CRISPR AGAGAGAATCAGAATAAGGA TGG (reversed) Intergenic
No off target data available for this crispr