ID: 1113245141 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:108386827-108386849 |
| Sequence | CTGTGAAGTGGTGTCATCTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1113245138_1113245141 | 6 | Left | 1113245138 | 13:108386798-108386820 | CCATCCTTATTCTGATTCTCTCT | No data | ||
| Right | 1113245141 | 13:108386827-108386849 | CTGTGAAGTGGTGTCATCTTTGG | No data | ||||
| 1113245139_1113245141 | 2 | Left | 1113245139 | 13:108386802-108386824 | CCTTATTCTGATTCTCTCTTTGT | No data | ||
| Right | 1113245141 | 13:108386827-108386849 | CTGTGAAGTGGTGTCATCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1113245141 | Original CRISPR | CTGTGAAGTGGTGTCATCTT TGG | Intergenic | ||
| No off target data available for this crispr | |||||