ID: 1113248694

View in Genome Browser
Species Human (GRCh38)
Location 13:108427617-108427639
Sequence CAACTGCTGCAGGGGATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113248687_1113248694 7 Left 1113248687 13:108427587-108427609 CCCATGCACAGGAGAGAGGCGGG No data
Right 1113248694 13:108427617-108427639 CAACTGCTGCAGGGGATCCAAGG No data
1113248683_1113248694 24 Left 1113248683 13:108427570-108427592 CCAACATGACACATCTGCCCATG No data
Right 1113248694 13:108427617-108427639 CAACTGCTGCAGGGGATCCAAGG No data
1113248689_1113248694 6 Left 1113248689 13:108427588-108427610 CCATGCACAGGAGAGAGGCGGGA No data
Right 1113248694 13:108427617-108427639 CAACTGCTGCAGGGGATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113248694 Original CRISPR CAACTGCTGCAGGGGATCCA AGG Intergenic
No off target data available for this crispr