ID: 1113249529

View in Genome Browser
Species Human (GRCh38)
Location 13:108436583-108436605
Sequence TGTTCCCTCTCCTGTGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113249524_1113249529 1 Left 1113249524 13:108436559-108436581 CCCACAACAGTCCCCGGTGTGTG No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249519_1113249529 7 Left 1113249519 13:108436553-108436575 CCCCACCCCACAACAGTCCCCGG No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249514_1113249529 29 Left 1113249514 13:108436531-108436553 CCAATGCTATCCCTTCCTTCTCC No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249526_1113249529 -10 Left 1113249526 13:108436570-108436592 CCCCGGTGTGTGATGTTCCCTCT No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249522_1113249529 5 Left 1113249522 13:108436555-108436577 CCACCCCACAACAGTCCCCGGTG No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249517_1113249529 14 Left 1113249517 13:108436546-108436568 CCTTCTCCCCCACCCCACAACAG No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249515_1113249529 19 Left 1113249515 13:108436541-108436563 CCCTTCCTTCTCCCCCACCCCAC No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249513_1113249529 30 Left 1113249513 13:108436530-108436552 CCCAATGCTATCCCTTCCTTCTC No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249521_1113249529 6 Left 1113249521 13:108436554-108436576 CCCACCCCACAACAGTCCCCGGT No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249518_1113249529 8 Left 1113249518 13:108436552-108436574 CCCCCACCCCACAACAGTCCCCG No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249525_1113249529 0 Left 1113249525 13:108436560-108436582 CCACAACAGTCCCCGGTGTGTGA No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249523_1113249529 2 Left 1113249523 13:108436558-108436580 CCCCACAACAGTCCCCGGTGTGT No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data
1113249516_1113249529 18 Left 1113249516 13:108436542-108436564 CCTTCCTTCTCCCCCACCCCACA No data
Right 1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113249529 Original CRISPR TGTTCCCTCTCCTGTGTCCA TGG Intergenic