ID: 1113251691

View in Genome Browser
Species Human (GRCh38)
Location 13:108460311-108460333
Sequence TGCCTTTGGCTGCAATGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113251691_1113251693 12 Left 1113251691 13:108460311-108460333 CCAGTACATTGCAGCCAAAGGCA No data
Right 1113251693 13:108460346-108460368 AACTTTAAAATGTGCTAATTTGG No data
1113251691_1113251694 13 Left 1113251691 13:108460311-108460333 CCAGTACATTGCAGCCAAAGGCA No data
Right 1113251694 13:108460347-108460369 ACTTTAAAATGTGCTAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113251691 Original CRISPR TGCCTTTGGCTGCAATGTAC TGG (reversed) Intergenic
No off target data available for this crispr