ID: 1113256926

View in Genome Browser
Species Human (GRCh38)
Location 13:108516121-108516143
Sequence CAGCGCGATTCCGTGGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113256918_1113256926 30 Left 1113256918 13:108516068-108516090 CCCCAGCCTCGTTGCCGCCTTGC 0: 316
1: 1145
2: 1873
3: 1683
4: 815
Right 1113256926 13:108516121-108516143 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1113256920_1113256926 28 Left 1113256920 13:108516070-108516092 CCAGCCTCGTTGCCGCCTTGCAG 0: 315
1: 1152
2: 1845
3: 1595
4: 741
Right 1113256926 13:108516121-108516143 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1113256922_1113256926 16 Left 1113256922 13:108516082-108516104 CCGCCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 1113256926 13:108516121-108516143 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1113256923_1113256926 13 Left 1113256923 13:108516085-108516107 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 1113256926 13:108516121-108516143 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1113256921_1113256926 24 Left 1113256921 13:108516074-108516096 CCTCGTTGCCGCCTTGCAGTTTG 0: 317
1: 1166
2: 1768
3: 1553
4: 836
Right 1113256926 13:108516121-108516143 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1113256919_1113256926 29 Left 1113256919 13:108516069-108516091 CCCAGCCTCGTTGCCGCCTTGCA 0: 317
1: 1173
2: 1908
3: 1654
4: 702
Right 1113256926 13:108516121-108516143 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113256926 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG Intergenic
Too many off-targets to display for this crispr