ID: 1113257773

View in Genome Browser
Species Human (GRCh38)
Location 13:108525686-108525708
Sequence TTCCTCAGTGGACCACTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113257769_1113257773 26 Left 1113257769 13:108525637-108525659 CCATAATCTACTTTTCGTTTAAC No data
Right 1113257773 13:108525686-108525708 TTCCTCAGTGGACCACTCTCTGG No data
1113257770_1113257773 4 Left 1113257770 13:108525659-108525681 CCAAGTGACTGAACTCTTTGTGG No data
Right 1113257773 13:108525686-108525708 TTCCTCAGTGGACCACTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113257773 Original CRISPR TTCCTCAGTGGACCACTCTC TGG Intergenic
No off target data available for this crispr