ID: 1113258586

View in Genome Browser
Species Human (GRCh38)
Location 13:108534560-108534582
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113258586_1113258591 -8 Left 1113258586 13:108534560-108534582 CCAATTCTACCCAGGAAGGGTGA No data
Right 1113258591 13:108534575-108534597 AAGGGTGAAAGTGGGAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113258586 Original CRISPR TCACCCTTCCTGGGTAGAAT TGG (reversed) Intergenic
No off target data available for this crispr