ID: 1113258925

View in Genome Browser
Species Human (GRCh38)
Location 13:108538843-108538865
Sequence CCAAGTTTGCAACTGGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113258925_1113258929 -10 Left 1113258925 13:108538843-108538865 CCAGTCACCAGTTGCAAACTTGG No data
Right 1113258929 13:108538856-108538878 GCAAACTTGGATCTGGCCACTGG No data
1113258925_1113258931 15 Left 1113258925 13:108538843-108538865 CCAGTCACCAGTTGCAAACTTGG No data
Right 1113258931 13:108538881-108538903 TCTGTAAGAATATTCAACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113258925 Original CRISPR CCAAGTTTGCAACTGGTGAC TGG (reversed) Intergenic
No off target data available for this crispr