ID: 1113268725

View in Genome Browser
Species Human (GRCh38)
Location 13:108648846-108648868
Sequence CTTCATGTATTGCTGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113268720_1113268725 8 Left 1113268720 13:108648815-108648837 CCTTATACTCAGAAAATCTGAAT 0: 1
1: 0
2: 2
3: 30
4: 337
Right 1113268725 13:108648846-108648868 CTTCATGTATTGCTGGATCAGGG 0: 1
1: 1
2: 3
3: 52
4: 338
1113268719_1113268725 9 Left 1113268719 13:108648814-108648836 CCCTTATACTCAGAAAATCTGAA 0: 1
1: 0
2: 1
3: 21
4: 316
Right 1113268725 13:108648846-108648868 CTTCATGTATTGCTGGATCAGGG 0: 1
1: 1
2: 3
3: 52
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113268725 Original CRISPR CTTCATGTATTGCTGGATCA GGG Intronic
901508683 1:9702988-9703010 CTTCAGGCATGGCTGGATCCAGG + Intronic
901760385 1:11467364-11467386 CTTCAGGTATAGCTTGATCCAGG + Intergenic
901826442 1:11864809-11864831 CATCAGGCATTGCTGGATCCAGG - Intergenic
901840113 1:11949013-11949035 CTTCAGGCATGGCTGGATCCAGG + Intronic
901866260 1:12109025-12109047 CTTCAGGCATGGCTGGATCCAGG + Intronic
901921542 1:12540785-12540807 CTTCAGGGATTGCTGGACCAGGG - Intergenic
902159352 1:14517394-14517416 CTTCGGGTGTGGCTGGATCAAGG - Intergenic
902905571 1:19554269-19554291 CTTCAGGTATGGCTGGATCCAGG - Intergenic
903475600 1:23617182-23617204 CTTCGGGCATTGCTGGATCCAGG - Intronic
904416783 1:30366922-30366944 CTTCAGGCATGGCTGGATCCGGG + Intergenic
904470220 1:30731429-30731451 CTTCAGGTATGGCAGGATCCAGG - Intergenic
904658447 1:32067070-32067092 CTTCAGGTATAGTTGGATCCAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904907774 1:33910825-33910847 CTTCAGGCAGTGCTGGATCAAGG - Intronic
905976614 1:42179791-42179813 CATCATGTGCTGCTGGTTCATGG + Exonic
907046093 1:51301056-51301078 CTTCAGGTAGGGCTGGATCCAGG - Intronic
907907353 1:58795290-58795312 CTTCACTTATTGCTACATCATGG - Intergenic
909107645 1:71432717-71432739 CTGGATGAATTGTTGGATCAAGG - Intronic
909218697 1:72926647-72926669 CTTTTTGTATTGCTAAATCAAGG - Intergenic
910228991 1:84967229-84967251 CTTCAGGAATAGCTGGATCCAGG - Intronic
912967265 1:114247628-114247650 GTTCATGTCTTGCAGGAACATGG + Intergenic
913414111 1:118586226-118586248 CTTTTTGTATGGCTGGGTCATGG - Intergenic
914439790 1:147694685-147694707 CTTCAGGTGCTGCTGGATCCAGG + Intergenic
915255329 1:154624120-154624142 CTTCAGGCATGGCTGGATCCTGG - Intronic
916909173 1:169326403-169326425 CTTCCTGTCTTTCTGGATCTTGG - Intronic
917080296 1:171251360-171251382 ATTCATCCATTGCTGGGTCAGGG + Intronic
922340987 1:224655081-224655103 CTTCATGGGTTGCTAGATCCTGG - Intronic
923730097 1:236542189-236542211 GTTCATGTAGTGCTGGGTGAAGG + Intronic
1064517389 10:16166320-16166342 CTTCCTGTACTGCTGAATCCTGG + Intergenic
1064541615 10:16411598-16411620 GTTTATGTATTGATAGATCAAGG - Intergenic
1065024752 10:21529719-21529741 CTTTCAGTATTGCTGCATCATGG + Intergenic
1065752268 10:28897572-28897594 TTTCATGTTTTCCTGGAGCAGGG + Intergenic
1068385513 10:56321845-56321867 CTTCAGGTTTTGCTGTATCAAGG + Intergenic
1068795718 10:61077573-61077595 CTTTAGGTATGGCTGGATCATGG + Intergenic
1074008416 10:109452286-109452308 CTTTTTGTATGGCTGGATTAGGG - Intergenic
1074368729 10:112881512-112881534 CTTCAGGTATAGTTTGATCAGGG - Intergenic
1075079377 10:119372610-119372632 CTTCAGGTATGGCTGGATCCAGG + Intronic
1078292358 11:10025528-10025550 CTTCATTTTCTCCTGGATCATGG + Intronic
1078355902 11:10631151-10631173 TTTCAGGTAGTGCTGGATCCAGG - Intronic
1078921260 11:15832808-15832830 CTTCAGATATGGCTGGATCTAGG - Intergenic
1080688678 11:34537216-34537238 CTTCAGGCATGGCTGGGTCAAGG - Intergenic
1080855256 11:36106419-36106441 CTTGATTTATTGCTGGATTCTGG + Intronic
1084607893 11:70183187-70183209 CTTCAGGCATGGCTGGATCCAGG + Intronic
1086124811 11:83339521-83339543 ATTTTTGTATTTCTGGATCACGG + Intergenic
1088079932 11:105899783-105899805 TTTAATGTATTGTTGGTTCATGG + Intronic
1088810004 11:113385855-113385877 CTTCAGGTATAAGTGGATCAAGG + Intergenic
1089118612 11:116115661-116115683 CTTCAGGTATGGCTGGATGCAGG + Intergenic
1091566855 12:1655243-1655265 CTGCATGTCGTGCTGGAACAGGG + Intergenic
1093122860 12:15294264-15294286 CTTAATGTATAGCAAGATCAAGG + Intronic
1093741156 12:22691498-22691520 CATCAAGTATTGCTAAATCAGGG - Intergenic
1098137504 12:67417990-67418012 GTTCAGGTATGGCTGGATCCAGG - Intergenic
1100451496 12:94711187-94711209 CTTCAGGTGTAGCTGGATCTAGG - Intergenic
1100786444 12:98083444-98083466 CTTCAGGTAAGGCTGGATCCAGG - Intergenic
1101377654 12:104184675-104184697 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1101403716 12:104410309-104410331 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1101770262 12:107743451-107743473 CTTTATGTATTGCTGGAAATAGG - Intronic
1101818860 12:108167576-108167598 CTTCAGGTATGGCTTGATCCAGG + Exonic
1102175894 12:110874528-110874550 CTTCAGGCATAGCTGGATCCAGG + Intronic
1102251907 12:111393287-111393309 TTTCAGGTATGGCTGGATCTAGG + Intergenic
1102542573 12:113633202-113633224 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1102888321 12:116538315-116538337 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1102890781 12:116557148-116557170 CTTCAGGCATGGCGGGATCAAGG + Intergenic
1102925520 12:116823077-116823099 CTTCAAGGATTCCTGGATCCAGG - Intronic
1103130378 12:118463165-118463187 CTTTATGTCTTGCTCCATCATGG + Intergenic
1103139901 12:118539517-118539539 CTTCAGGTATAGCTGGATGCAGG + Intergenic
1103445468 12:120992163-120992185 CTTCAGGCATGGCTAGATCAAGG + Intronic
1103975965 12:124702944-124702966 CTTCAGGTACAGCTGGATCCAGG + Intergenic
1103979266 12:124726021-124726043 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104051601 12:125198308-125198330 CTTCAGGTATGGCTGGGTCCAGG + Intronic
1104398993 12:128460239-128460261 CTTCAGGCATGGCTGGATCAAGG + Intronic
1104434515 12:128745178-128745200 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104584106 12:130034080-130034102 CTTCAGGCATCGCTGGATCAAGG + Intergenic
1104743707 12:131196790-131196812 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1104743726 12:131196998-131197020 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1104746759 12:131215526-131215548 CTTCAGGTGTGGCTGGATCCAGG - Intergenic
1104790613 12:131479715-131479737 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1104958708 12:132478108-132478130 CTTCAGGTCTAGCTGGATCCAGG + Intergenic
1106276584 13:28214672-28214694 CTTCAAGTATTCCTGGGTCTTGG + Intronic
1106470229 13:30047663-30047685 CTGCTTGTAAGGCTGGATCACGG + Intergenic
1108296172 13:49019702-49019724 TTTAATGTATTGCTGGATTGGGG + Intronic
1111275887 13:85946312-85946334 TTTCATGTATTGTTCCATCAAGG + Intergenic
1111528613 13:89507541-89507563 TATCTTGTGTTGCTGGATCAGGG - Intergenic
1112405698 13:99118335-99118357 CTTCATGTGTTTCTTGAGCAGGG + Intergenic
1113268725 13:108648846-108648868 CTTCATGTATTGCTGGATCAGGG + Intronic
1114184590 14:20390899-20390921 CTTCATGTATTTTTGGATGGTGG + Intronic
1114288123 14:21265050-21265072 ATTCATGTATAGTTGGCTCAAGG - Intronic
1118596591 14:67440435-67440457 CTTGATCCACTGCTGGATCATGG + Intergenic
1119161960 14:72460025-72460047 CTTCAGGGAGGGCTGGATCAAGG + Intronic
1119647653 14:76359941-76359963 CTTCAGGTATGGTTGGATCCAGG + Intronic
1120317280 14:82911745-82911767 CTTCAAGTATTGCAGAGTCAGGG - Intergenic
1120839942 14:89076801-89076823 CTTCAGGTATAACTGGATCCAGG + Intergenic
1121799012 14:96757920-96757942 TTTCAGGCATTGCTGGATCCAGG + Intergenic
1122048091 14:99037615-99037637 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1122061922 14:99141621-99141643 CTTCAGGTACGGCTGGATCCAGG - Intergenic
1122652578 14:103233511-103233533 CTTCAGGTAGGGCTGGATCCAGG + Intergenic
1123758432 15:23414917-23414939 CTTCAGGAACGGCTGGATCAAGG + Intergenic
1128529636 15:68435546-68435568 CTGCAGGTGTGGCTGGATCAAGG + Intergenic
1129152089 15:73695750-73695772 CTTCAGGCATAGCTGGATCCAGG + Intronic
1131777704 15:95820188-95820210 TTTCATGTTTTGCTGTCTCATGG - Intergenic
1132215318 15:100057878-100057900 CTTCAGGCACTGCTGGATCCAGG - Intronic
1132354360 15:101160104-101160126 TTTCAGGTATGGCTGGATCCAGG + Intergenic
1132657491 16:1047353-1047375 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1133337789 16:5017363-5017385 CTTCAGATATGGCTGGATCCAGG + Exonic
1133338537 16:5022049-5022071 CTTCAGGTATAGCTGGATCCAGG + Intergenic
1133431461 16:5740610-5740632 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1134040096 16:11061811-11061833 CTTCAGGCATGGCTGGATCCGGG + Intronic
1134124076 16:11604473-11604495 CTTCAGGCATGGCTGGATCCAGG + Intronic
1134340253 16:13338224-13338246 CTTCAGGTGTGGCTGGATCCAGG - Intergenic
1134365028 16:13569179-13569201 CTTCAGGTATGGCTGAATCCAGG - Intergenic
1134457908 16:14407964-14407986 CTTCAGGAATGGCTGGATCCAGG - Intergenic
1134506105 16:14808410-14808432 CTTCAGGTATGGCTCGATCAAGG + Intronic
1134574445 16:15320360-15320382 CTTCAGGTATGGCTCGATCAAGG - Intergenic
1134584969 16:15402469-15402491 CATCAAGTAATGCTGGCTCAGGG - Intronic
1134687233 16:16167378-16167400 CTTCAGGTATGGCTGGATGTAGG - Intronic
1134693687 16:16207493-16207515 CCTCAGGTGTTGCTGGATCAGGG - Intronic
1134727970 16:16435943-16435965 CTTCAGGTATGGCTCGATCAAGG + Intergenic
1134939466 16:18275883-18275905 CTTCAGGTATGGCTCGATCAAGG - Intergenic
1134978158 16:18587150-18587172 CCTCAGGTGTTGCTGGATCAGGG + Intergenic
1135037326 16:19089224-19089246 CTTCAGGTATTGCTTGATCCAGG + Intergenic
1135048843 16:19176091-19176113 CTTCAGGCATAGCTGGATCCAGG + Intronic
1135114553 16:19713902-19713924 CTTCAGGTATGGCTGGATCTAGG - Intronic
1135527380 16:23224312-23224334 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1135542817 16:23345442-23345464 CTTCAGGCATGGCTGGATCCAGG + Intronic
1135806113 16:25544454-25544476 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1135813121 16:25607907-25607929 CTCCATGTACTGCTGGCTCCGGG - Intergenic
1135942030 16:26830284-26830306 CTTCAGGTATGGCTGGATTCAGG - Intergenic
1136014228 16:27384803-27384825 TTTCAGGCATAGCTGGATCAAGG + Intergenic
1136092366 16:27929605-27929627 CTTCAGGCATGGCTGGATCCAGG - Intronic
1136140180 16:28283349-28283371 TTTCAGGCATAGCTGGATCAAGG + Intergenic
1136379385 16:29885359-29885381 CTTCATGAATGTCTGGATCCAGG - Intronic
1137264166 16:46855035-46855057 TTTCAGGTATGGCTGGATCCAGG + Intergenic
1137756061 16:50903301-50903323 CTTCAGGGATTGCTGGATACAGG + Intergenic
1137840854 16:51639690-51639712 CTTCAGGTATTGCTGGATCAAGG + Intergenic
1138246132 16:55468455-55468477 TTTCAGGTATAGCTGGATCCAGG + Intronic
1138381450 16:56605659-56605681 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1141157609 16:81608302-81608324 CTTCAGGCATTGCTGGATCCGGG + Intronic
1141988234 16:87593918-87593940 CTTCAGGTACTGCTGGATCCAGG + Intergenic
1142124806 16:88404968-88404990 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1142608204 17:1093909-1093931 CTGCATGGATTGTTGGATCTGGG - Intronic
1143019042 17:3907086-3907108 CTTCAGGTATGGCTGAATCCAGG - Intronic
1143831860 17:9658774-9658796 CTTCAGGTAGGGCTGGATCCAGG + Intronic
1144871214 17:18372651-18372673 ATTCAGGAATTGCTTGATCAGGG + Intergenic
1147654691 17:42082172-42082194 CTTCATGTCTGGCTGAATCCTGG + Intergenic
1149117829 17:53119383-53119405 CTTCAGGCATAGCAGGATCAAGG + Intergenic
1149388204 17:56163369-56163391 CTTCATGTATTGCTCGAGGCTGG - Intronic
1150160572 17:62894436-62894458 CTTCAGGTATGGCTGGATCTAGG + Intergenic
1151506215 17:74529236-74529258 CTTCATCTGTGCCTGGATCATGG + Intronic
1151994449 17:77599896-77599918 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1155426624 18:25714038-25714060 CTGCATTTCTTGCTGGAGCAAGG - Intergenic
1156900392 18:42294337-42294359 CTTTATTTCTTGCTGGATAAAGG + Intergenic
1157719327 18:49911751-49911773 ATTCATCCATTGCTGGGTCAGGG + Intronic
1157808030 18:50672768-50672790 CACCCTTTATTGCTGGATCAAGG + Intronic
1159087881 18:63814698-63814720 CTTGATGTTTTGCTGGATTTGGG + Intergenic
1160678507 19:402964-402986 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1161316678 19:3620576-3620598 CTTCAGGTAAGGCTGGATCCAGG - Intronic
1161503024 19:4627921-4627943 CTTCAGGTATGGTTGGATCCAGG + Intergenic
1161762755 19:6186625-6186647 CTTCAGGCATGGCTGGATCTGGG + Intronic
1161859451 19:6787079-6787101 CTTCAGGTCTGGCTGGATCCAGG + Intronic
1162467461 19:10850774-10850796 CTTCAGGTATGGCTAGATCCAGG + Intronic
1162468099 19:10854893-10854915 CTTCAGATATGGCTGGATCCAGG + Intronic
1162522818 19:11192094-11192116 CTTCAGGCATGGCTGGATCCAGG - Intronic
1162896271 19:13766274-13766296 CTTCAGGTATGGCAAGATCAAGG + Intronic
1163015879 19:14454170-14454192 ATTCATCTATTGGTGGATCTGGG - Intronic
1163177125 19:15572172-15572194 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1163186872 19:15644994-15645016 CTTCAGGCATGGCTGGATCCAGG + Intronic
1163201845 19:15775412-15775434 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1163217919 19:15894546-15894568 CTTCAGGCATGGCTGGATCCAGG - Intronic
1163461783 19:17442769-17442791 CTTCAGGTGTGGCTGGATCCAGG - Intronic
1163535682 19:17874915-17874937 CTTCAGGCATGGCTGGATCCAGG + Intronic
1163566944 19:18057595-18057617 TTTCAGGTATGGCTGGATCCAGG + Intergenic
1163616015 19:18328813-18328835 CTTCAACTATAGCTGGATCCAGG - Intergenic
1163654137 19:18535872-18535894 CTTCAGGCATAGCTGGATCCAGG - Intronic
1163761484 19:19139194-19139216 CTTCAGGCGTGGCTGGATCAAGG + Intergenic
1163784422 19:19267453-19267475 CTTCAGGTATGGCTGGATCCAGG - Intronic
1164464355 19:28474993-28475015 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1164643252 19:29841658-29841680 CCTCAGGCATGGCTGGATCAGGG + Intergenic
1164669784 19:30065885-30065907 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1164916251 19:32054469-32054491 CTTCAGGTATAGCTGGATCCAGG - Intergenic
1165334695 19:35161296-35161318 CTTCAGGCATAGCTGGATCAAGG + Intronic
1165340274 19:35206436-35206458 TTTCAGGTATGGCTGGATCCAGG - Intergenic
1165454871 19:35904516-35904538 CTTCAGGAATGGCTGGATCCAGG + Exonic
1165468836 19:35991322-35991344 CTTCAGGTCTGGCTGGTTCAAGG + Intergenic
1165766664 19:38355776-38355798 CTTCAGGTATGGCTGGATCCAGG + Intronic
1166104763 19:40591850-40591872 CTTCAGGCATGGCTGGATCCGGG + Intergenic
1166929789 19:46295553-46295575 GTTCAGGTATGGCTGGATCCAGG + Intergenic
1167090737 19:47341866-47341888 CTTCAGGCATAGCTGGATCCAGG + Exonic
1167567960 19:50268677-50268699 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567967 19:50268720-50268742 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567974 19:50268763-50268785 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567982 19:50268806-50268828 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167634747 19:50648048-50648070 CTTCAGGCATTGCTGGATCCAGG + Intronic
927233063 2:20844342-20844364 ATTCATGAATTCATGGATCATGG + Intergenic
928013224 2:27629909-27629931 CTTCATGTACTGCTGGATCCAGG - Exonic
928228986 2:29479624-29479646 CTTCATGTATTGCTGGGTTCAGG + Intronic
929785725 2:44989664-44989686 CTTCAAGTATAATTGGATCAAGG + Intergenic
931465449 2:62482781-62482803 CTTCAGGCATGGCTGCATCAAGG - Intergenic
933532584 2:83529373-83529395 CTTCCTGGATGGCTGGCTCAGGG + Intergenic
934985598 2:98882576-98882598 CTTCAGGAATAGCTGGATCCAGG - Intronic
937921702 2:127136094-127136116 CTTCATGGATGGATGGATGAGGG + Intergenic
939630403 2:144521777-144521799 CTTAATATAGTGTTGGATCAGGG - Intronic
940308407 2:152250903-152250925 CTTCAGGCATGGCTGGATCAAGG - Intergenic
941089575 2:161159650-161159672 CTCCCTGTATTTCTGAATCATGG - Intronic
941163933 2:162065251-162065273 ATTCATGTTCTGCTGTATCAGGG - Intronic
941975836 2:171404359-171404381 CTTCAGGTAATCCTGGATCATGG + Intronic
945158894 2:206868109-206868131 CTTCAGGCATGGCTGGATCTTGG - Intergenic
945814550 2:214588380-214588402 ATACATATATTGCTGGATAAAGG + Intergenic
946059597 2:216930364-216930386 CTTCAGGTATAGCTGGACCCAGG + Intergenic
947520505 2:230842410-230842432 CTTCATGAATGACTGGGTCAGGG - Intergenic
947765753 2:232635998-232636020 CTTCAGGTGTGGCTGGATCTAGG + Intronic
948898982 2:240946573-240946595 CTTCAGGTATGGCTGGATTCAGG + Intronic
949055270 2:241924750-241924772 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1168842756 20:920295-920317 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1168845029 20:938630-938652 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1169268490 20:4181954-4181976 CTTCAGGTACTGCTGGATCATGG - Exonic
1169390255 20:5185061-5185083 CTTCATGTCTTCCTGGAGAAAGG + Intronic
1169484119 20:6012323-6012345 CTTCCACTCTTGCTGGATCATGG - Intronic
1169860487 20:10146317-10146339 CTTCAGGTATGGCTGGATCCAGG - Intergenic
1169892670 20:10470455-10470477 CTTCCTGTATTACTTAATCATGG - Intronic
1171234128 20:23510549-23510571 CTTCAGGGATTGCTGAATTAGGG - Intergenic
1172058004 20:32167660-32167682 CTTCAGGTCTGGCTGGATCCAGG + Intergenic
1172692867 20:36802702-36802724 CTTCAGGTATAGCTGGATCCAGG - Intronic
1172692875 20:36802757-36802779 CTTCAGGTATAGCTGGATCTAGG - Intronic
1173378324 20:42510995-42511017 ATTCATGGATTGATGGATTAAGG + Intronic
1173895686 20:46549053-46549075 CTTCAGGCATTTCTGGATCCAGG - Intronic
1173934486 20:46849442-46849464 CTTCAGGAATGGCTGGATCTAGG + Intergenic
1173945742 20:46949505-46949527 GTTCAGGTATAGCTGGATCAGGG + Intronic
1174068423 20:47882864-47882886 CTTCAGGTACTGCTGCATCCGGG + Intergenic
1174129397 20:48331664-48331686 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1174187165 20:48714715-48714737 CTTCAGGTATGGCTGGATCATGG - Intronic
1174267755 20:49344328-49344350 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1174268624 20:49350510-49350532 CTTCAGGTGTGGCTGGATCCAGG - Intergenic
1174274511 20:49393997-49394019 CTTCAGGGATGGCTGGATCCAGG - Intronic
1174326109 20:49780197-49780219 TTTCAGGTATGGCTGGATCCAGG + Intergenic
1174427179 20:50440005-50440027 CTTCAGGAATGGCTGGATCCAGG - Intergenic
1174502361 20:50995019-50995041 CTTCAGGAACTGCTGGATCTAGG + Intergenic
1174515070 20:51085736-51085758 TTTCAGGTATGGCTGGATCCAGG + Intergenic
1174540269 20:51283867-51283889 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1174581809 20:51577608-51577630 CTTCAGGAATTGCATGATCAAGG - Intergenic
1175052009 20:56164400-56164422 CTTCAGGTATAGCTGGATGCAGG - Intergenic
1175062709 20:56258198-56258220 CTTCAGGCGTAGCTGGATCATGG - Intergenic
1175118195 20:56698699-56698721 CTTCAGGTACAGCTGGATCCGGG + Intergenic
1175134426 20:56812289-56812311 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1175249788 20:57602303-57602325 CTTCAGGAATGACTGGATCAAGG + Intergenic
1175331334 20:58166680-58166702 CCTCATACATTGGTGGATCATGG - Intergenic
1175711094 20:61221681-61221703 CTTGATGTGTTGCTGGAACAAGG + Intergenic
1175721610 20:61290886-61290908 CTTCAGGCATGGCTGGATCCAGG + Intronic
1175738176 20:61401565-61401587 CTTCAGGTGTGGCTGGATCCAGG + Intronic
1175820376 20:61905928-61905950 CTTCAGGCATGGCTGGATCTAGG + Intronic
1177072889 21:16532998-16533020 TTTCTTGTTTTGCTGAATCATGG + Intergenic
1180655064 22:17413394-17413416 CTTAATGTATTGCTGTGTCTTGG + Intronic
1181732519 22:24857910-24857932 CTTCCTGTGCTCCTGGATCAGGG - Intronic
1181821535 22:25479506-25479528 CTTCAGGTATGGCTGTATCCAGG - Intergenic
1181822205 22:25485106-25485128 CTTCAGGTATGGCTTGATCCAGG - Intergenic
1181961961 22:26628649-26628671 CTTCAAGCATAGCTGGATCCAGG + Intronic
1181991856 22:26842921-26842943 CATCAGGTATGGCTGGATCTAGG - Intergenic
1182109470 22:27712706-27712728 CTTCAGGCATGGCTGGATCTAGG - Intergenic
1182127929 22:27829750-27829772 CTTCAGGTATGGCTGGATTCAGG + Intergenic
1182215651 22:28715349-28715371 CTTCAGGCATGGCTGGATCTAGG - Intronic
1182323993 22:29497804-29497826 CTTCAGGAATGGCTGGATCCAGG + Intergenic
1183261737 22:36799809-36799831 CTTCAGGAACAGCTGGATCAAGG - Intergenic
1185238102 22:49726216-49726238 CTTCAGGAATGGCTGGATCCAGG + Intergenic
949581208 3:5390194-5390216 CTTCATGTTTTCCTTGATCTTGG + Intergenic
949843858 3:8351016-8351038 ATTCAGGTATGGCTGGATCCAGG - Intergenic
949922345 3:9013017-9013039 CTTCAGGTATAGCTTGATCCAGG - Intronic
950192901 3:10990633-10990655 CTTCAGGTATGGCTGGATCCAGG + Intergenic
950532310 3:13559294-13559316 CTTCAGGCATGGCTGGATCCAGG + Intronic
950686833 3:14624549-14624571 CTTCAGGTATAGCTAGATCTAGG - Intergenic
951576298 3:24117702-24117724 CTTCAGGCATGGCTGGATCTGGG - Exonic
952001735 3:28793776-28793798 CTAGATGTAGGGCTGGATCAAGG + Intergenic
952333797 3:32387733-32387755 CTTCAGGCATGGCTGGATCCAGG - Intergenic
953727285 3:45411100-45411122 ATTCATTTGTTGCTGGGTCAGGG - Intronic
955047881 3:55376943-55376965 CTTCAGGCATGGCTGGATCCAGG + Intergenic
955079094 3:55641206-55641228 CTTCAGGTATGGCTGCATCTAGG - Intronic
955198281 3:56826203-56826225 CTTCAGGCATGGCTGGATCCAGG - Intronic
955352003 3:58200494-58200516 CTTCAGGCATAGCTGGATCCAGG - Intronic
955542437 3:59991881-59991903 CTTCAGGTATGGCTTGATCCAGG - Intronic
956004033 3:64760208-64760230 GTTCAGGTAAGGCTGGATCAGGG + Intergenic
956188315 3:66583415-66583437 CTTCCTGTGGTGCTGGACCACGG - Intergenic
956451872 3:69382892-69382914 CTTTAGGTATTGTTTGATCAGGG - Intronic
956487321 3:69736787-69736809 CTTCAGGTATGGTTGGAACAAGG + Intergenic
956722885 3:72133818-72133840 CTTCAGGTATAGCTGGATCCAGG + Intergenic
956736309 3:72241172-72241194 CTTCAGGCATGGCTGGATCAAGG + Intergenic
956752632 3:72355512-72355534 CTTCATGCATGGCTGGATCCAGG - Intergenic
956779777 3:72594788-72594810 CATCAGGCATTGCTGGATCCAGG + Intergenic
957028560 3:75213988-75214010 CTTCAGGGATAGCTGGATCTAGG - Intergenic
957732977 3:84166279-84166301 GTTCCTGTATTGCTGCATTATGG + Intergenic
958699173 3:97566688-97566710 CTGCAGGTATGGCTGGATCTAGG + Intronic
961184712 3:124904660-124904682 CTTCAGGTATGGTTTGATCAAGG + Intergenic
961442942 3:126963488-126963510 CTTCAGGTCTGGCTGGATCCAGG - Intergenic
961469062 3:127100180-127100202 CTTCAGGCATGGCTGGATCCAGG + Intergenic
961537622 3:127579633-127579655 CTTCAGGTATGGCTGGATCCAGG - Intronic
962257418 3:133882042-133882064 CTACATTTCTTTCTGGATCAGGG + Intronic
962805483 3:138924063-138924085 CTTCAGGTATAACTGGATCCAGG + Intergenic
962835839 3:139187715-139187737 CTTCATGAATGGATGGATCCAGG + Intronic
962848715 3:139291839-139291861 GTTTCTGTAATGCTGGATCATGG - Intronic
963233968 3:142937503-142937525 CTTCAAGAATAGCTGGATCTAGG - Intergenic
964199183 3:154098796-154098818 CTTCAGGTATTGGTGGATCCAGG - Intergenic
964688231 3:159421286-159421308 CTCTGTGTATTGCTGTATCATGG + Intronic
965976747 3:174633800-174633822 CTTCATTTAATGATGAATCATGG - Intronic
966167381 3:177035743-177035765 ATTCATCCATTGCTGGGTCAGGG - Intronic
967762895 3:193244850-193244872 ATTCATGGATTACTGGATTAAGG - Intronic
970867964 4:20780787-20780809 CATCAGGCATGGCTGGATCAAGG - Intronic
971251631 4:24977385-24977407 TTTCAGGAATGGCTGGATCAAGG - Intronic
971447116 4:26762833-26762855 CTGCCTGTATTCCTGGCTCATGG - Intergenic
971936065 4:33149062-33149084 CCTCAAGCATTGCTGGATCCAGG - Intergenic
972298141 4:37759998-37760020 CTTCAGGTATGGCTAGATCTAGG + Intergenic
975543991 4:75543358-75543380 CTTCAGGTACAGCTGGATCTAGG + Intronic
975890618 4:79022799-79022821 CTCCATGTAGTGCTGGAACCTGG + Intergenic
976929587 4:90549193-90549215 CATCATGTTTTGCTAAATCATGG - Intronic
978197928 4:105991980-105992002 CTTCATGTCCTCCTGGCTCATGG + Intronic
979611824 4:122697582-122697604 CTTCATGTCTTGGTGGCACATGG + Intergenic
984871924 4:184333206-184333228 ATTCTTGTTTTGCTTGATCATGG - Intergenic
985585427 5:730580-730602 CTTCAAGAATGCCTGGATCATGG + Intronic
985598938 5:814903-814925 CTTCAAGAATGCCTGGATCATGG + Intronic
987392740 5:17391197-17391219 CTTCAGGGATGGCTGGATCCAGG + Intergenic
989123476 5:38027939-38027961 GTTGCTGTTTTGCTGGATCATGG + Intergenic
990856165 5:60268810-60268832 CTTAATATATTTTTGGATCATGG - Intronic
991612408 5:68463083-68463105 CTTCATATATGGCTGGATCCAGG + Intergenic
993675671 5:90813334-90813356 CTCCATTAATTACTGGATCATGG + Intronic
994211082 5:97088093-97088115 CTCCAGGTATATCTGGATCAAGG - Intergenic
995230477 5:109755838-109755860 CTTCAGGTATTGCTGTATCCAGG + Intronic
997726743 5:136127251-136127273 CTTCAGGTACAGCTGGATCCAGG + Intergenic
998207657 5:140170345-140170367 TTTCAGGTATAGCTGGATCCAGG - Intergenic
998397806 5:141830492-141830514 CTTCAGGCATAGCTGAATCAAGG + Intergenic
998765040 5:145477217-145477239 CTTCAGGTACAGCTGGATCCAGG + Intronic
999104431 5:149058109-149058131 CTTCAGATATTGCTAAATCAAGG - Intronic
999115315 5:149157800-149157822 CTTCAGGTATGGCTGGATTAGGG - Intronic
999145914 5:149393754-149393776 CTTTAGGTATGGCTGGATCCAGG - Intronic
999685384 5:154098152-154098174 CTTCAGGTATGGCTGGATAGAGG + Intronic
1001163635 5:169343746-169343768 CTTCTTATATTGCTGGATCCAGG - Intergenic
1001198762 5:169697186-169697208 CTTCAGGCATAGCTGGATCCAGG + Intronic
1001437466 5:171711330-171711352 CTTCATGTATTATTTGATCAAGG + Intergenic
1001524265 5:172417440-172417462 CTTCAGGTGTGGCTGGATCTAGG - Intronic
1001897460 5:175393757-175393779 CCTCAGGAATGGCTGGATCATGG + Intergenic
1001966877 5:175916102-175916124 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1002051108 5:176571958-176571980 CTTCAGGCATGGCTGGATCCAGG + Intronic
1002129688 5:177072849-177072871 CTTCAGGCATAGCTGGATCCAGG - Intronic
1002250069 5:177923104-177923126 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1002451414 5:179321003-179321025 CTTCAGGTGTGGCTGGATCCAGG - Intronic
1002534982 5:179871137-179871159 CTTCAGGCATGGCTGGATCCAGG - Intronic
1002919142 6:1553944-1553966 CTTCATGTATTGTAGGAGCTGGG + Intergenic
1005514088 6:26538210-26538232 CTTCTTGTCTTGCTAGATCGGGG + Intergenic
1010875914 6:81105504-81105526 CTTCATGGATTCCTGAATCAAGG + Intergenic
1012349995 6:98238446-98238468 TGTCATGTATTGCTGGAATAGGG + Intergenic
1016748272 6:147604842-147604864 CTTATTGGATTGCTGGAGCATGG + Intronic
1019346322 7:532535-532557 TTTCAGGCATGGCTGGATCAGGG + Intergenic
1019975156 7:4575435-4575457 CTTCAGGTATGGCTTGATCCAGG + Intergenic
1020095991 7:5369671-5369693 TTTCAGGTATGGCTGGATCTAGG - Intronic
1020254389 7:6494550-6494572 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1021054413 7:16029097-16029119 CTTCATGCATTGGTTGATGAGGG + Intergenic
1021117819 7:16763447-16763469 CATAAGGTTTTGCTGGATCAAGG + Intronic
1022601862 7:31768393-31768415 ATTCATCTGTTGTTGGATCAAGG + Intronic
1022630105 7:32076758-32076780 CTTCAGGCATAGCAGGATCAGGG - Intronic
1025323146 7:58170311-58170333 CTTCATTTATTGCTAGACTAAGG + Intergenic
1025537467 7:61972537-61972559 CTTCATTTATTGCTAGACTAAGG + Intergenic
1029029166 7:97450410-97450432 CTTCATGTCTTGCTGCATGCAGG + Intergenic
1032470404 7:132174549-132174571 CTTCAGGTCTTGGAGGATCATGG - Intronic
1033776718 7:144619680-144619702 TTTCATCTGTTGCTGGGTCAGGG + Intronic
1037224430 8:16567873-16567895 CGGAAGGTATTGCTGGATCAGGG - Intergenic
1037750857 8:21681392-21681414 TTTTTTGTATTGCTGAATCAAGG - Intergenic
1039867370 8:41517241-41517263 CTTCATGTCTTGCTAGATACAGG - Intergenic
1040672854 8:49713236-49713258 CATCTTGTTTTGCTGGATAAGGG + Intergenic
1041460981 8:58111577-58111599 CTTCATTTATTGATGATTCACGG - Intronic
1041522330 8:58770290-58770312 CTCTATGTAGTGCTGGCTCAGGG + Intergenic
1042880957 8:73488394-73488416 ATTTATGTCTTGCTGGTTCAAGG + Intronic
1043136888 8:76539089-76539111 CTTTATGAATGGCTGGATCAAGG + Intergenic
1043987669 8:86713550-86713572 CTTCATTTATGAATGGATCAAGG - Intronic
1046648875 8:116814954-116814976 CTTCATGTCTTGTTGGAACTTGG + Intronic
1046987566 8:120405482-120405504 CTTGATGCATTGCTGGTTTATGG + Intronic
1047723362 8:127663221-127663243 AGTCATGTGTTGCTTGATCATGG - Intergenic
1047728956 8:127709995-127710017 CTTCAGGTACAGTTGGATCAAGG - Intergenic
1048842009 8:138574861-138574883 CTTCAGGTATTGGAGGACCATGG - Intergenic
1050365137 9:4867170-4867192 CTTCAGGTAAAGCTGGATCTAGG + Intronic
1055079885 9:72258534-72258556 ATCCATGTATTCCTGAATCAGGG - Intergenic
1055450219 9:76424517-76424539 CTTCAGGTAAGGCTGGATCTTGG + Intronic
1055649175 9:78390292-78390314 CATCAGGTATAGCTGGATCCAGG - Intergenic
1058721839 9:107771595-107771617 CTTCAAGCATTGTGGGATCAGGG - Intergenic
1059235312 9:112755723-112755745 CTTCAGGGATGGCTGGAGCAAGG + Intronic
1059373626 9:113864031-113864053 CTTCAGGTCTGGCTGGATCTAGG + Intergenic
1060395875 9:123316137-123316159 ATTCAGGTATGGCTGGATCTAGG + Intergenic
1060870676 9:127037549-127037571 CTTCAAATATTGCTGAATCTAGG + Intronic
1061297415 9:129684309-129684331 CTTCAGGCACTGCTGGATCCAGG + Intronic
1185627425 X:1492583-1492605 CTTCAGGCATGGCTGGATCCAGG - Intronic
1187561471 X:20407412-20407434 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1188063671 X:25631149-25631171 CTTCATGTAGTAGTGGCTCAGGG + Intergenic
1188733986 X:33689232-33689254 TTTCATGTATTGCTGCATGTTGG - Intergenic
1189238890 X:39510263-39510285 CTTCAGGTATGGCTAGATCTAGG + Intergenic
1189420614 X:40854448-40854470 ATTCAAGTATGGCTGGATCCAGG - Intergenic
1190407187 X:50099819-50099841 TTTCATGCCTTGCTGGAACACGG + Intergenic
1193872351 X:86815510-86815532 CTTCATGTAGTACTGGCTCTAGG - Intronic
1194392365 X:93335810-93335832 TTTCATAAATTGTTGGATCAAGG + Intergenic
1195790810 X:108583137-108583159 CTTAATGTATTTCTGCAACATGG - Intronic
1196668474 X:118341560-118341582 CTTCAGGTATGGCTGGATCCAGG - Intergenic
1198194699 X:134348385-134348407 GTTCAGATATGGCTGGATCAAGG - Intergenic
1201334603 Y:12867103-12867125 CTTCATTTATTCCTGCAACAAGG + Intergenic