ID: 1113269314

View in Genome Browser
Species Human (GRCh38)
Location 13:108655534-108655556
Sequence ACTAGGCAGTGCCCCAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 15, 1: 42, 2: 72, 3: 90, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113269314_1113269322 21 Left 1113269314 13:108655534-108655556 CCTCCACTGGGGCACTGCCTAGT 0: 15
1: 42
2: 72
3: 90
4: 211
Right 1113269322 13:108655578-108655600 CCATCTTCCAGACCCCAGAATGG 0: 67
1: 862
2: 1366
3: 1582
4: 1484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113269314 Original CRISPR ACTAGGCAGTGCCCCAGTGG AGG (reversed) Intronic